Advances in Clinical and Experimental Medicine

Title abbreviation: Adv Clin Exp Med
Journal Impact Factor (JIF 2025) – 2.5
Journal Citation Indicator (JCI 2025) – 0.40
Scopus CiteScore (2025) – 4.2
Index Copernicus Value (ICV 2024) – 161.00
MNiSW – 70 pts
ISSN 1899–5276 (print), ISSN 2451-2680 (online)
Periodicity – monthly

Download original text (EN)

Advances in Clinical and Experimental Medicine

2024, vol. 33, nr 6, June, p. 601–608

doi: 10.17219/acem/169977

Publication type: original article

Language: English

License: Creative Commons Attribution 3.0 Unported (CC BY 3.0)

Download citation:

  • BIBTEX (JabRef, Mendeley)
  • RIS (Papers, Reference Manager, RefWorks, Zotero)

Cite as:


Dominiak M, Leszczyszyn A, Łaczmańska I, et al. Relationship in development of malocclusions to polymorphisms of selected vitamin D receptors. Adv Clin Exp Med. 2024;33(6):601–608. doi:10.17219/acem/169977

Relationship in development of malocclusions to polymorphisms of selected vitamin D receptors

Marzena Dominiak1,A,B,C,D,E,F, Anna Leszczyszyn1,A,B,C,D,E, Izabela Łaczmańska2,A,B,C,D, Monika Machoy3,A,B,C, Hanna Gerber4,C,D,E, Joseph Choukroun5,C,D,E, Tomasz Gedrange6,C,D,E, Sylwia Hnitecka4,C,D,E

1 Department of Dental Surgery, Wroclaw Medical University, Poland

2 Department of Genetics, Wroclaw Medical University, Poland

3 Department of Orthodontics, Pomeranian Medical University, Szczecin, Poland

4 Department of Maxillofacial Surgery, Wroclaw Medical University, Poland

5 Private Pain Clinic, Nice, France

6 Department of Orthodontics, Technische Universität Dresden, Germany

Graphical abstract


Graphical abstracts

Abstract

Background. The development of malocclusion is related to various factor, many of which are still not fully explained. The steroid hormone, 1,25-dihydroxyvitamin D3, has pleiotropic effects. It plays a key role in skeletal metabolism and the control of cell repair by attaching to the nuclear vitamin D steroid receptor (VDR). This vitamin affects bone turnover through the processes of bone tissue formation and resorption via its action on cells of the osteoblastic and osteoclastic lineage, exerts a modulating effect on the immune system, and is involved in the regulation of cell proliferation and differentiation. The role of vitamin D3 (VD3) and its receptor polymorphisms is a rarely studied topic in dentistry. Due to the proven influence on bone turnover processes and immune responses, the main research topic is its relation to periodontal diseases, but so far, its role in the formation and development of malocclusions has not been assessed.

Objectives. This study aimed to assess the association of selected VDR polymorphisms: Cdx2 (rs11658820), TaqI (rs7975232), BsmI (rs1544410), ApaI (rs7975232), and FokI (rs2228570) with the development of malocclusions.

Materials and methods. A prospective observational study was performed. The examination consisted of a medical interview, intra- and extraoral orthodontic diagnosis, alginate impression, cone beam computed tomography (CBCT), and venous blood sample to obtain genomic DNA and assess VDR polymorphisms.

Results. The rs11658820 polymorphism causes an almost 4-fold increase in the probability of the presence of a malocclusion. GT and TT genotypes of rs7975232 are also associated with a similar risk – almost 6 and almost 5 times higher, respectively. In turn, the effect of the rs2228570-AG and GG genotype polymorphisms on the occurrence of transversal anomalies was demonstrated (odds ratio (OR) = 8.46 and OR = 6.92, respectively).

Conclusions. The association of individual polymorphisms with specific malocclusions should be carefully assessed, especially since some trends have been indicated.

Key words: vitamin D, orthodontics, VDR, malocclusion

Background

The development of skeletal and maxillary defects is related to various general prenatal, postnatal and local factors. Many etiological factors of occlusal anomalies are still not fully explained. Proffit et al. distinguished 3 categories of malocclusion etiologies: specific, environmental and genetic.1, 2 General factors include endocrine disorders (which can cause, among others, gigantism or acromegaly) or systemic diseases such as rickets.3, 4 The environmental factors include dysfunctions of, e.g., swallowing, posture, breathing, chewing, and speech, and parafunctions, such as sucking lips, cheeks, fingers, and the presence of caries causing premature loss of deciduous teeth.5 Malocclusion can be divided into 3 planes.6 There are 3 groups of malocclusions: vertical (e.g., deep bite, open bite), horizontal (i.e., prognathism, retrognathia) and transverse (buccal, crossbite, lingual crossbite – often associated with a deficiency in the growth of one of the arches, maxilla or mandible).

Vitamins have an enormous influence on facial development.7, 8, 9, 10, 11 Vitamin D (VD) is produced by the skin after sun exposure or provided in the diet. Calcitriol becomes an active fat-soluble hormone. It exerts pleiotropic effects on the body, having significant functional and regulatory effects. Its autocrine and paracrine activities complete the endocrine activity, which controls the absorption of calcium and phosphorus through the direct stimulation of the vitamin D receptor (VDR) in tissues. Acting as a neuro-mediator, it influences the production of antioxidants and regulates the cell’s growth. Vitamin D3 (VD3) plays a key role in skeletal metabolism (mostly bone turnover) by attaching to nuclear steroid receptors (Figure 1).12, 13, 14, 15 Expression and nuclear activation of the VDR are necessary for the effects of VD. Several genetic variations have been identified in the VDR. The VDR gene is located on chromosome 12 (12q12–q14). It consists of 9 exons encoding a protein with 427 amino acids. This receptor belongs to the nuclear receptor superfamily of ligand-activated transcription factors. It induces genomic regulation of downstream targets involved in numerous biological activities, i.e., calcium and phosphate homeostasis in bone metabolism. Vitamin D receptor participates in the actions of VD, establishing a heterodimer with the retinoid x receptor (RXR). The RXR-VDR complex translocates into the nucleus and binds the VD response element (VDRE) in the promoter regions of VD target genes.16 The genes that code for the enzymes, receptors and transporters that participate in VD metabolism are highly polymorphic. Due to this, the presence of single nucleotide polymorphisms (SNPs) in specific genes influences VD serum levels and their activity.17

More studies focusing on the importance of VDR polymorphisms prove their connection with various diseases, such as osteoporosis, colorectal cancer risk, gastrointestinal diseases, and regulation of host–bacterial interactions.13, 14, 18, 19, 20 The role of VD3 and VDR polymorphisms is a rarely studied topic in dentistry. Due to the proven influence on bone turnover processes and immune responses, the main research topic is its relation to periodontal diseases. Unfortunately, its role is not fully explained.21, 22 So far, its possible influence on the formation and development of malocclusions has not been assessed.

Objectives

This study aimed to prospectively assess the impact of VDR polymorphisms which are most often analyzed, recorded and known in the literature, and which have been associated with various effects on many diseases – Cdx2 (rs11658820), TaqI (rs7975232), BsmI (rs1544410), ApaI (rs7975232), and FokI (rs2228570) – on the development of malocclusion.

Materials and methods

Study group

A prospective observational study was carried out in a randomly selected group of 113 patients in a private dental practice in Wrocław between 2017 and 2018. The analysis included patients of both sexes, Caucasians above 18 years of age, who came for dental check-ups. The exclusion criteria were age of the patients (<18 years) and lack of consent to participate in at least 1 component of the study. Also, patients with severe diseases that can have a significant impact on skeletal dysmorphisms (such as fibrous dysplasia and cherubism) and those that can change the occlusions, such as trauma to the craniofacial skeleton or maxillofacial surgeries, were excluded.

Research components

The examination consisted of 4 parts: 1) a medical interview; 2) an assessment of the oral cavity in the orthodontic aspect with an alginate impression for the diagnostic model; 3) radiographic images; and 4) a venous blood sample to obtain genomic deoxyribonucleic acid (DNA) and assess VDR polymorphisms. The medical interview included: demographic data (age, sex), habits (smoking, alcohol consumption) and comorbidities. A detailed examination of the oral cavity assessed:

– canine class and Angle’s class1 on both sides; if the first molar or canine was missing, the class on this side was not assessed;

– vertical and horizontal bite [mm];

– crowding on the 3-point scale in the maxilla and the mandible:

• 1st degree (no space for half of the incisor),

• 2nd degree (no space for 1.5 incisors),

• 3rd degree (no space for 2 or more incisors),

• the 2nd and 3rd degree (indications for extraction treatment);

– malocclusion (in the sagittal, horizontal, and orbital planes).

Each patient underwent an alginate impression to prepare a diagnostic model for analysis, an intraoral photograph showing the upper and lower incisors, and volumetric tomography of the maxillary and mandibular regions using Carestream® (Carestream Health, New York, USA). The models were analyzed using the Pont,23 Korkhaus24 and Popovich25 indices.

Laboratory analysis

Laboratory tests of peripheral blood collected from the antecubital fossa were carried out. The following polymorphisms were analyzed: Cdx2 (rs11568820), TaqI (rs731236), ApaI (rs7975232), BsmI (rs1544410), and FokI (rs2228570). BsmI and ApaI stemmed from substitution in intron 8. TaqI resulted from a substitution of cytosine (C) with thymine (T) in exon 9. These SNPs are situated near the 3’-UTR, which is a 3’-3’-Untranslated Region. They are believed to alter the stability of the mRNA of VDR. Cdx2 in exon 1 influences VDR transcriptional activity (G allele decreases relative to the A allele). FokI in exon 2 is the start codon for the VDR gene and involves a change of ATG to ACG.26

Genomic DNA from peripheral lymphocytes was isolated from the 200 μL of whole blood using Prepito DNA Blood D250 Kit and chemagic. Prepito® instruments (PerkinElmer, Waltham, USA) were used strictly according to the producer’s protocol.

The primer sequences for polymerase chain reaction (PCR) were previously described by Lins et al.27 (Table 1). Polymerase chain reaction was performed using Taq polymerase (5 U/μL), 0.5 μL, provided with ×10 buffer with 15 mM MgCl2, 2 μL (Qiagen, Hilden, Germany); dNTPs (2 mM each, Fermentas, Burlington, Canada), 2 μL; all primers (10 mM; Generi Biotech, Hradec Králové, Czech Republic), 1 μL of each; extracted DNA, 2 μL; and H2O for a final volume of 20 μL. The cycle parameters were as follows: initial denaturation at 95°C for 5 min, 35 cycles of 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, followed by a final extension at 72°C for 10 min in a T-100 thermocycler (Bio-Rad, Hercules, USA) (Figure 2). The products were evaluated using a 2.5% agarose gel. Conditions of polymerase chain reaction (PCR) were previously described by Laczmanski et al.18, 19, 20

Cdx2, ApaI, BsmI, FokI, and TaqI VDR gene polymorphisms were genotyped using SNaPshot reaction according to the producer’s protocol (SNaPshot Multiplex Kit; Applied Biosystems, Waltham, USA).

Obtained products were separated using an ABI 310 Genetic Analyzer with GeneScan Analysis v. 3.1.2 software (Applied Biosystems/Thermo Fisher Scientific, Waltham, USA), Matrix Standard Set DS-02 for dye set E5 and the GeneScan 120 LIZ dye Size Standard (Applied Biosystems/Thermo Fisher Scientific) for 15 min. The results were analyzed using GeneMarker v. 1.85 software (SoftGenetics LLC, State College, USA).

Statistical analyses

The statistical analysis was carried out using Statistica v. 13.3 software (TIBCO Software Inc., Palo Alto, USA). Allele frequencies were assessed by gene counting, and the distribution of the polymorphic variants was tested against the Hardy–Weinberg equilibrium (HWE). The HWE was analyzed using the χ2 test. As the data include only 2 options (yes/no), the results are presented in multi-way tables (contingency) in the form of cardinality (n) and a structure index (%). The χ2 tests of independence were used to assess the significance of the relationship between the occurrence of malocclusions and variants of genotypes, and in the case of 4-field tables (2×2), when the numbers expected in one of the cells were lower than 5, Fisher’s exact test was used.

We intend to recruit 113 participants. The sample size calculation was based on the study report by Mozaffari-Khosravi et al.28 and Föcker et al.,29 where VD differences and influence were measured. Score points were used as input for the sample size calculation, which yielded a final sample size of 81 participants (t-test, α = 0.05; powered at 80% to detect a true difference). Attrition was assumed to be 20%, demanding the recruitment of 100 participants. Tests for deviations from the HWE were separately performed using χ2 distribution for each SNP. Bonferroni correction to multiple testing was done.

The study was conducted according to the guidelines of the Declaration of Helsinki, and the Bioethics Committee’s approval was obtained (approval No. KB-442/2017 by the Bioethics Committee of Wroclaw Medical University). We used the STrengthening the Reporting of OBservational studies in Epidemiology (STROBE) cross-sectional checklist when writing our study.

Results

The analysis included 113 patients (52 men and 61 women) aged 18–62 years (mean 36.5 ±11.8 years), who voluntarily completed their medical interview, participated in a clinical trial and donated a blood sample for laboratory tests.

The profile of the examined people can be described as generally healthy people, with a relatively high quality of life. Accompanying systemic diseases in examined group was only 13.2% (autoimmune – 13.2%, gastrointestinal – 8.8%, cardiovascular – 4.4%, metabolic – 0.9%).

The Hardy–Weinberg law of frequencies of rs11568820, rs731236, rs7975232, rs1544410, and rs2228570 polymorphism genotypes in the population was checked. The distribution of genotypes of all these 5 polymorphisms did not deviate from equilibrium.

Malocclusion anomalies

For most of the patients, Angle’s and canine 1st class anomalies were diagnosed (right side 49.1%, left side 46.5%, right side 66.7%, left side 67.5%, respectively). Concerning the teeth’s position, the teeth were crowded in the mandible (n = 47, 41.6%) and the maxilla (n = 32, 28.3%). The reduction of the upper arch (n = 43, 38.1%) and changes in overbite (n = 29, 25.7%) were relatively frequent. Other irregularities were diagnosed less frequently. The frequency of occurrence of particular defects (in detail) in the studied population is presented in Table 2.

Cdx2 (rs11568820)

Patients with the T allele present were over 4 times more likely to develop a narrower upper arch than those without this allele (OR = 4.4). Also, patients with a T allele present were over 16 times more likely to develop shortened upper arches (OR = 16.3) (Table 3).

FokI (rs2228570)

At the significance level of α = 0.05, there is no basis to reject the null hypothesis that the FokI genotype contributes to the occurrence of a widened lower arch. However, a p = 0.0842 may indicate a certain tendency of dependence on the influence of the polymorphic form of AA on the more frequent occurrence of a widened lower arch (Table 4).

BsmI (rs1544410)

At the significance level of α = 0.05, there is no basis to reject the null hypothesis that the BsmI genotype affects the occurrence of widened lower arches. However, a p = 0.0738 may indicate a tendency for the influence of the polymorphic form of CC on the more frequent occurrence of this malocclusion. At the significance level of α = 0.05, there is no basis to reject the null hypothesis that the BsmI genotype affects the occurrence degrees of freedom (df) widened upper arches. However, p = 0.0816 may indicate a certain tendency. The fact that in the study group, the CC genotype does not occur in people with a widened upper arch is probably significant. The fact is that people with a widened upper arch are poorly represented (only 3) (Table 5).

No statistically significant correlations were found between the occurrence of other malocclusions and the previously described polymorphisms.

TaqI (rs731236) and ApaI (rs7975232)

At the significance level of α = 0.05, there was no significant difference in the genotype distribution or the allele frequencies of VDR TaqI and ApaI (rs7975232) between patients with analyzed dental anomalies and controls.

Discussion

Based on the analysis of articles available in the PubMed database, it was determined that this is the first study to investigate the association between the VDR polymorphisms Cdx2 (rs11658820), TaqI (rs7975232), BsmI (rs1544410), ApaI (rs7975232) and FokI (rs2228570), and the occurrence of dental malocclusion. For this reason, it is not possible to compare the results obtained with other similar analyses. The commonly known factors that influence the development of dental malocclusions may not be considered modifiable. By understanding the negative impact of parafunctions, one can try to prevent them, thus reducing the risk of occlusal anomalies.

In our previous analysis, we wanted to determine whether VD deficiency could promote the development of dental malocclusion. We studied a group of 113 patients. Vitamin D3 deficiency was found in about ¾ of the study participants. This study showed that VD3 deficiency could be one of the significant factors affecting the development of the jaw. The patients had a higher risk of a narrowed (OR = 4.4) and shortened arch (OR = 16.3). Thus, there was a correlation between the deficiency of this hormone and the underdevelopment of the maxilla. The analysis showed that patients largely do not supplement this hormone, and if they do, it is in a dosage that is too low.29 In another publication, the relationship between a low level of VD and the narrowing of the upper dental arch, crowding and crossbite was demonstrated. It can be concluded that there is a connection between this hormone deficiency and the underdevelopment of the upper jaw.30

The rs11658820 polymorphism is located upstream in the 5’ UTR of the gene and significantly alters the transcriptional activity of the promoter region of VDR. The rs2228570 polymorphism is located in promoter region 5’ of exon 2 and causes the synthesis of a longer protein, which is not so effective as a transcriptional activator of VDR. The rs1544410 polymorphism is located in the last intron. The rs7975232 polymorphism is also located in the last intron and affects stability of mRNA and translational activity of VDR while rs731236 polymorphism (located in exon 9) leads to silent codon generation.31

VDR polymorphisms are mostly investigated with their effects on systemic diseases such as multiple sclerosis,32 allergic diseases33 and malignancies.20, 34, 35 With regard to bone metabolism and related diseases, the main search is for associations with the risk of developing osteoporosis and low bone mineral density. A recent meta-analysis showed that VDR BsmI genotype is associated with increased risk of postmenopausal osteoporosis in Caucasians but not in Asians. Thus, the authors demonstrated the differences arising from race in the populations studied. Recently, the study of VD and its receptor has been gaining importance, including in the craniofacial field. Yildiz et al.36 investigated the possible association between the VDR-BsmI variant and susceptibility to temporomandibular joint disorders (dislocation with reduction (DDR) and VD) in a group of 114 Turkish patients. Vitamin D levels were significantly different between patients and controls. They found that VD levels were significantly lower in the DDR patients. Interestingly, their study showed that VDR genotype distributions were different in the 2 groups regarding the BsmI variant. There was a statistically significant difference between the 2 studied groups regarding genotype distribution and allele frequency, people with bb genotypes, and B alleles. They concluded that the VDR BsmI BB genotype was increased in the controls compared to DDR patients, and homozygous individuals with BB genotypes had a 2.03-fold higher protective role against developing DDR.36

Dental research pays attention to the importance of the VDR gene in various types of cancer (including head and neck cancers). It is believed that polymorphisms in VDR gene may influence both prognosis and the risk and incidence of cancer.37 Studies by Małodoba-Mazur et al.38 indicated a genetic link between the occurrence of oral cancer and rs2238135 in the VDR gene38, 39 compared with healthy patients. The VDR Tt genotype has been shown to be significantly more common for patients with oral squamous cell carcinoma (OSCC) than in those with other genotypes. Women, in particular, were at increased risk of this malignancy. Studies indicate that the VDR TaqI polymorphism may be related to the susceptibility of OSCC. Moreover, genetic polymorphisms in the VDRs and genes involved in VD metabolism, such as CYP24B1 and CYP27B1, may influence susceptibility to OSCC. Zeljic et al.40 showed that the polymorphism of the CYP24A1 gene might influence the susceptibility to the development of oral cancers, and the polymorphism of the FokI VDR gene may be considered a prognostic factor, as it has been shown to be associated with mortality.40

Analyses were also conducted regarding the relationship between VDR and the risk of caries. The results were inconclusive, although not excluding the existence of such an impact.41, 42 Available research is often conducted on periodontitis, whose etiology is known to be multifactorial, with a significant genetic role. This disease results in the progressive loss of alveolar bone, inevitably leading to the loss of support for the teeth and, consequently, tooth loss. Susceptibility to this pathology is analyzed in various aspects, including VDR polymorphisms. Although the meta-analysis by Wan et al. did not show the association of the ApaI polymorphism with the development of periodontal disease in either Caucasian or Asian patients, the authors found a link between this disease entity and the FokI and BsmI polymorphisms in both ethnic groups. Additionally, FokI has been associated with susceptibility to aggressive periodontitis in the Chinese population. TaqI, on the other hand, has an impact on periodontal disease in the Caucasian population.22

Our prospective study similarly showed a significant effect of Cdx2 and the possible tendency of FokI and BsmI on jaw development. Our results show an association between VD and jaw growth, especially maxillary underdevelopment. Therefore, conclusions can be drawn that the reduction in VD leads to a reduced size of the jaw.

Recently, other aspects of the hormone in question have also been indicated. Vitamin D also plays an important role in the healing and osseointegration of implants. It was found that the first period after implant surgery crucially depends on the role of this hormone in the induction of anti-inflammatory cytokines and a reduction in the level of proinflammatory cytokines, thus reducing the body’s response to surgical intervention. Moreover, it affects the processes of activation and differentiation of osteoblasts and osteoclasts, increasing osteoid mineralization. These mechanisms are also important in the later period – after loading the implant with a prosthetic crown.43 Another study found that adequate levels of 25-hydroxycholecalciferol on the day of surgery and VD deficiency treatment significantly increase bone levels at the implant site in the process of radiologically assessed osseointegration.44

Limitations

This was the first in a series of prospective studies to initially determine whether there were relationships between the development of malocclusions and specific VDR polymorphisms. Due to the complexity of the planned study definition, including not only clinical evaluation but also laboratory tests, a relatively small group of patients was included in the analysis, but one that allows for a meaningful statistical evaluation. Further similar studies are planned with the participation of a much larger number of people and among different patient groups focused especially on the analysis of those relationships for which certain tendencies have been demonstrated.

Conclusions

For some of the analyzed SNPs, real trends and an increased risk of development of anomalies and malocclusion were shown. The limitation of this study is the relatively small number of samples. The analysis of a larger population may identify other significant relations. Due to the demonstration of racial differences, it is worth considering conducting such studies among representatives of the Caucasian race and various other ethnic groups.

Tables


Table 1. Polymerase chain reaction (PCR) primers designed to amplify fragments harboring the 5 vitamin D receptor (VDR) single nucleotide polymorphism (SNP) according to Lins et al.27

Single nucleotide polymorphism

PCR primer forward/reverse/
SNaPshot probe sequences

Polymorphism

Size of product [bp]

PCR primer forward/reverse

ApaI (rs7975232)

TaqI (rs731236)

F 5`CTGCCGTTGAGTGTCTGTGT

242

R 5`TCGGCTAGCTTCTGGATCAT

BsmI (rs15444410)

F 5`CCTCACTGCCCTTAGCTCTG

209

R 5`CCATCTCTCAGGCTCCAAAG

FokI (rs2228570)

F 5`GGCCTGCTTGCTGTTCTTAC

147

R 5`TCACCTGAAGAAGCCTTTGC

Cdx2 (rs11568820)

F 5`CATTGTAGAACATCTTTTGTATCAGGA

224

R 5`GACAAAAAGGATCAGGGATGA

SNaPshot probe sequences

rs7975232

(T)12GTGGTGGGATTGAGCAGTGAGG

G/T

34

rs15444410

(T)21CAGAGCCTGAGTATTGGGAATG

C/T

43

rs2228570

(T)31GCTGGCCGCCATTGCCTCC

A/G

50

rs731236

(T)9GCGGTCCTGGATGGCCTC

A/G

27

Table 2. The frequency of occurrence of particular defects (detailed) in the studied population

Type of malocclusion anomalies

Presence of a defect

yes

n (%)

no

n (%)

Upper arch

narrowed

31 (27.4)

82 (72.6)

widened

3 (2.65)

110 (97.35)

shortened

3 (2.65)

110 (97.35)

spaced

15 (13.3)

98 (86.7)

Lower arch

narrowed

14 (12.4)

99 (87.6)

widened

6 (5.3)

107 (94.7)

shortened

2 (1.8)

111 (98.2)

spaced

6 (5.3)

107 (94.7)

Crowding

maxilla

32 (28.3)

81 (71.7)

mandible

47 (41.6)

66 (58.4)

Distoclusions

class II

10 (8.8)

103 (91.2)

retrognathia

16 (14.15)

97 (85.85)

Tête-à-tête

8 (7.1)

(92.9)

Mesioclusion

class III

4 (3.5)

(96.5)

prognathism

5 (4.4)

(95.6)

Vertical malocclusions

anterior open bite

3 (2.65)

(97.35)

lateral open bite

1 (0.9)

(99.1)

deep bite

22 (19.5)

(80.5)

Transverse malocclusions

buccal crossbite

18 (15.9)

(84.1)

lingual crossbite

2 (1.8)

(98.2)

n – number of people.
Table 3. Malocclusion depending on the variants of the Cdx2 (rs11568820) genotype. Test result (p) and the odds ratio (OR); df = 1

Genotype

Upper arch-narrowed

Pearson’s χ2 test

p-value

OR (95% CI)

Upper arch-shortened

Pearson’s χ2 test

p-value

OR (95% CI)

no

yes

no

yes

CC

76 (76.8%)

23 (23.2%)

7.085

0.0078

1.00 (ref.)

98 (99.0%)

1 (1.0%)

8.364

0.0038

1.00 (ref.)

TC

6 (42.9%)

8 (57.1%)

4.4 (1.38–14.01)

12 (85.7%)

12 (14.3%)

16.3 (1.38–193.9)

95% CI – 95% confidence interval
Table 4. Malocclusion depending on the variants of the FokI (rs2228570) genotype. Test result (p); degrees of freedom (df) = 2

Genotype

Lower arch-widened

Pearson’s χ2 test

p-value

no

yes

GG

31 (96.88%)

1 (3.13%)

4.948

0.0842

AG

49 (98.00%)

1 (2.00%)

AA

27 (87.10%)

4 (12.90%)

Table 5. Malocclusion depending on the variants of the BsmI (rs1544410) genotype. Test result (p); degrees of freedom (df) = 2

Genotype

Lower arch-spaced

Pearson’s χ2 test

p-value

Lower arch-widened

Pearson’s χ2 test

p-value

no

yes

no

yes

TT

20 (100.00%)

0 (0.00%)

5.212

0.0738

18 (90.00%)

2 (10.00%)

5.011

0.0816

CT

43 (97.73%)

1 (2.27%)

43 (97.73%)

1 (2.27%)

CC

37 (88.10%)

5 (11.90%)

42 (100.00%)

0 (0.00%)

Figures


Fig. 1. Vitamin D (VD) hydroxylation and vitamin D receptor (VDR) activity
Fig. 2. Capillary electrophoresis

References (44)

  1. Rapeepattana S, Thearmontree A, Suntornlohanakul S. Etiology of malocclusion and dominant orthodontic problems in mixed dentition: A cross-sectional study in a group of Thai children aged 8–9 years. J Int Soc Prevent Community Dent. 2019;9(4):383. doi:10.4103/jispcd.JISPCD_120_19
  2. Proffit WR. Contemporary Orthodontics. 6th ed. Philadelphia, USA: Elsevier; 2018. ISBN:978-0-323-54387-3.
  3. Fanghänel J, Gedrange T. On the development, morphology and function of the temporomandibular joint in the light of the orofacial system. Ann Anat. 2007;189(4):314–319. doi:10.1016/j.aanat.2007.02.024
  4. Weingärtner J, Maile S, Fanghänel J, Proff P, Gedrange T. Growth-related changes of parameters of the methylation cycle and jejunal aminopeptidase M in the rat. Exp Toxicol Pathol. 2008;59(5):291–295. doi:10.1016/j.etp.2007.09.004
  5. Øgaard B, Larsson E, Lindsten R. The effect of sucking habits, cohort, sex, intercanine arch widths, and breast or bottle feeding on posterior crossbite in Norwegian and Swedish 3-year-old children. Am J Orthod Dentofacial Orthop. 1994;106(2):161–166. doi:10.1016/S0889-5406(94)70034-6
  6. Fanghänel J, Gedrange T, Proff P. The face-physiognomic expressiveness and human identity. Ann Anat. 2006;188(3):261–266. doi:10.1016/j.aanat.2005.11.013
  7. Krawiec M, Dominiak M. The role of vitamin D in the human body with a special emphasison dental issues: Literature review. Dent Med Probl. 2018;55(4):419–424. doi:10.17219/dmp/99051
  8. Krawiec M, Dominiak M. Prospective evaluation of vitamin D levels in dental treated patients: A screening study. Dent Med Probl. 2021;58(3):321–326. doi:10.17219/dmp/134911
  9. Weingärtner J, Lotz K, Fanghänel J, Gedrange T, Bienengräber V, Proff P. Induction and prevention of cleft lip, alveolus and palate and neural tube defects with special consideration of B vitamins and the methylation cycle. J Orofac Orthop. 2007;68(4):266–277. doi:10.1007/s00056-007-0701-6
  10. Weingärtner J, Maile S, Proff P, et al. Secondary palatal closure in ats in association with relative maternofetal levels of folic acid, vitamin B12, and homocysteine. Ann Anat. 2007;189(3):229–233. doi:10.1016/j.aanat.2006.10.006
  11. Weingartner J, Proff P, Fanghanel J, et al. Different bone sesitivity to malformations induced by procarbazine in fetal rats. J Physiol Pharmacol. 2008;59(Suppl 5):17–25. PMID:19075321.
  12. Suh KT, Eun IS, Lee JS. Polymorphism in vitamin D receptor is associated with bone mineral density in patients with adolescent idiopathic scoliosis. Eur Spine J. 2010;19(9):1545–1550. doi:10.1007/s00586-010-1385-y
  13. El Jilani MM, Mohamed AA, Zeglam HB, et al. Association between vitamin D receptor gene polymorphisms and chronic periodontitis among Libyans. Libyan J Med. 2015;10(1):26771. doi:10.3402/ljm.v10.26771
  14. Imani D, Razi B, Motallebnezhad M, Rezaei R. Association between vitamin D receptor (VDR) polymorphisms and the risk of multiple sclerosis (MS): An updated meta-analysis. BMC Neurol. 2019;19(1):339. doi:10.1186/s12883-019-1577-y
  15. Ho YP, Lin YC, Yang YH, et al. Association of vitamin D receptor gene polymorphisms and periodontitis in a Taiwanese Han population. J Dent Sci. 2017;12(4):360–367. doi:10.1016/j.jds.2017.07.001
  16. Gasperini B, Visconti VV, Ciccacci C, et al. Role of the vitamin D receptor (VDR) in the pathogenesis of osteoporosis: A genetic, epigenetic and molecular pilot study. Genes. 2023;14(3):542. doi:10.3390/genes14030542
  17. Rojo-Tolosa S, Márquez-Pete N, Gálvez-Navas JM, et al. Single nucleotide polymorphisms in the vitamin D metabolic pathway and their relationship with high blood pressure risk. Int J Mol Sci. 2023;24(6):5974. doi:10.3390/ijms24065974
  18. Laczmanska I, Laczmanski L, Bebenek M, et al. Vitamin D receptor gene polymorphisms in relation to the risk of colorectal cancer in the Polish population. Tumor Biol. 2014;35(12):12397–12401. doi:10.1007/s13277-014-2554-0
  19. Laczmanski L, Milewicz A, Puzianowska-Kuznicka M, et al. Interrelation between genotypes of the vitamin D receptor gene and serum sex hormone concentrations in the Polish elderly population: The PolSenior study. Exp Gerontol. 2014;57:188–190. doi:10.1016/j.exger.2014.06.007
  20. Laczmanski L, Lwow F, Mossakowska M, et al. Association between vitamin D concentration and levels of sex hormones in an elderly Polish population with different genotypes of VDR polymorphisms (rs10735810, rs1544410, rs7975232, rs731236). Gene. 2015;559(1):73–76. doi:10.1016/j.gene.2015.01.022
  21. Murthykumar K, Arjunkumar R, Jayaseelan VP. Association of vitamin D receptor gene polymorphism (rs10735810) and chronic periodontitis. J Invest Clin Dent. 2019;10(4):e12440. doi:10.1111/jicd.12440
  22. Wan QS, Li L, Yang SK, Liu ZL, Song N. Role of vitamin D receptor gene polymorphisms on the susceptibility to periodontitis: A meta-analysis of a controversial issue. Genet Test Mol Biomarkers. 2019;23(9):618–633. doi:10.1089/gtmb.2019.0021
  23. Joondeph DR, Riedel RA, Moore AW. Pont’s index: A clinical evaluation. Angle Orthod. 1970;40(2):112–118. doi:10.1043/0003-3219(1970)040<0112:PIACE>2.0.CO;2
  24. Korkhaus G. Present orthodontic thought in Germany. Am J Orthod. 1960;46(4):270–287. doi:10.1016/0002-9416(60)90195-0
  25. Popovich F, Thompson GW. Craniofacial templates for orthodontic case analysis. Am J Orthod. 1977;71(4):406–420. doi:10.1016/0002-9416(77)90244-5
  26. Nakhl S, Sleilaty G, Chouery E, Salem N, Chahine R, Farès N. FokI vitamin D receptor gene polymorphism and serum 25-hydroxyvitamin D in patients with cardiovascular risk. Arch Med Sci Atheroscler Dis. 2019;4(1):298–303. doi:10.5114/amsad.2019.91437
  27. Lins TCL, Nogueira LR, Lima RM, Gentil P, Oliveira RJ, Pereira RW. A multiplex single-base extension protocol for genotyping Cdx2, FokI, BsmI, ApaI, and TaqI polymorphisms of the vitamin D receptor gene. Genet Mol Res. 2007;6(2):316–324. PMID:17573662.
  28. Mozaffari-Khosravi H, Nabizade L, Yassini-Ardakani SM, Hadinedoushan H, Barzegar K. The effect of 2 different single injections of high dose of vitamin D on improving the depression in depressed patients with vitamin D deficiency: A randomized clinical trial. J Clin Psychopharmacol. 2013;33(3):378–385. doi:10.1097/JCP.0b013e31828f619a
  29. Föcker M, Antel J, Grasemann C, et al. Effect of an vitamin D deficiency on depressive symptoms in child and adolescent psychiatric patients. A randomized controlled trial: Study protocol. BMC Psychiatry. 2018;18(1):57. doi:10.1186/s12888-018-1637-7
  30. Leszczyszyn A, Hnitecka S, Dominiak M. Could vitamin D3 deficiency influence malocclusion development? Nutrients. 2021;13(6):2122. doi:10.3390/nu13062122
  31. Yesil S, Tanyildiz HG, Tekgunduz SA, et al. Vitamin D receptor polymorphisms in immune thrombocytopenic purpura. Pediatrics International. 2017;59(6):682–685. doi:10.1111/ped.13273
  32. Liao JL, Qin Q, Zhou YS, et al. Vitamin D receptor Bsm I polymorphism and osteoporosis risk in postmenopausal women: A meta-analysis from 42 studies. Genes Nutr. 2020;15(1):20. doi:10.1186/s12263-020-00679-9
  33. Gnagnarella P, Raimondi S, Aristarco V, et al. Vitamin D receptor polymorphisms and cancer. In: Reichrath J, ed. Sunlight, Vitamin D and Skin Cancer. Vol. 1268. Advances in Experimental Medicine and Biology. Cham, Switzerland: Springer International Publishing; 2020:53–114. doi:10.1007/978-3-030-46227-7_4
  34. Zhang L, Zhang S, He C, Wang X. VDR gene polymorphisms and allergic diseases: Evidence from a meta-analysis. Immunol Invest. 2020;49(1-2):166–177. doi:10.1080/08820139.2019.1674325
  35. Shaikh F, Baig S, Jamal Q. Do VDR gene polymorphisms contribute to breast cancer? Asian Pac J Cancer Prev. 2016;17(2):479–483. doi:10.7314/APJCP.2016.17.2.479
  36. Yildiz S, Tumer MK, Yigit S, Nursal AF, Rustemoglu A, Balel Y. Relation of vitamin D and BsmI variant with temporomandibular diseases in the Turkish population. Br J Oral Maxillofac Surg. 2021;59(5):555–560. doi:10.1016/j.bjoms.2020.08.101
  37. Fathi N, Ahmadian E, Shahi S, et al. Role of vitamin D and vitamin D receptor (VDR) in oral cancer. Biomed Pharmacother. 2019;109:391–401. doi:10.1016/j.biopha.2018.10.102
  38. Małodobra-Mazur M, Paduch A, Lebioda A, et al. VDR gene single nucleotide polymorphisms and their association with risk of oral cavity carcinoma. Acta Biochim Pol. 2012;59(4):627–630. PMID:23189278.
  39. Khammissa RAG, Fourie J, Motswaledi MH, Ballyram R, Lemmer J, Feller L. The biological activities of vitamin D and its receptor in relation to calcium and bone homeostasis, cancer, immune and cardiovascular systems, skin biology, and oral health. Biomed Res Int. 2018;2018:9276380. doi:10.1155/2018/9276380
  40. Zeljic K, Jovanovic I, Jovanovic J, Magic Z, Stankovic A, Supic G. MicroRNA meta-signature of oral cancer: Evidence from a meta-analysis. Ups J Med Sci. 2018;123(1):43–49. doi:10.1080/03009734.2018.1439551
  41. Cogulu D, Onay H, Ozdemir Y, Aslan GI, Ozkinay F, Eronat C. The role of vitamin D receptor polymorphisms on dental caries. J Clin Pediatr Dent. 2016;40(3):211–214. doi:10.17796/1053-4628-40.3.211
  42. Barbosa MCF, Lima DC, Reis CLB, et al. Vitamin D receptor FokI and BglI genetic polymorphisms, dental caries, and gingivitis. Int J Paediatr Dent. 2020;30(5):642–649. doi:10.1111/ipd.12631
  43. Trybek G, Aniko-Wlodarczyk M, Kwiatek J, et al. The effect of vitamin D3 on the osteointegration of dental implant. Baltic J Health Phys Act. 2018;15(7):25–33. doi:10.29359/BJHPA.10.4.02
  44. Kwiatek J, Jaroń A, Trybek G. Impact of the 25-hydroxycholecalciferol concentration and vitamin D deficiency treatment on changes in the bone level at the implant site during the process of osseointegration: A prospective, randomized, controlled clinical trial. J Clin Med. 2021;10(3):526. doi:10.3390/jcm10030526