Advances in Clinical and Experimental Medicine

Title abbreviation: Adv Clin Exp Med
5-Year IF – 2.0, IF – 1.9, JCI (2024) – 0.43
Scopus CiteScore – 4.3
Q1 in SJR 2025, SJR score – 0.599, H-index: 54 (SJR)
ICV – 161.00; MNiSW – 70 pts
Initial editorial assessment and first decision within 24 h

ISSN 1899–5276 (print), ISSN 2451-2680 (online)
Periodicity – monthly

Download original text (EN)

Advances in Clinical and Experimental Medicine

2021, vol. 30, nr 6, June, p. 599–605

doi: 10.17219/acem/133485

Publication type: original article

Language: English

License: Creative Commons Attribution 3.0 Unported (CC BY 3.0)

Download citation:

  • BIBTEX (JabRef, Mendeley)
  • RIS (Papers, Reference Manager, RefWorks, Zotero)

Cite as:


Tang YL, Wang XB, Zhou Y, Wang YP, Ding JC. Ginsenoside Rg1 induces senescence of leukemic stem cells by upregulating p16INK4a and downregulating hTERT expression. Adv Clin Exp Med. 2021;30(6):599–605. doi:10.17219/acem/133485

Ginsenoside Rg1 induces senescence of leukemic stem cells by upregulating p16INK4a and downregulating hTERT expression

Yan-Long Tang1,B,C,D,E,F, Xiao-Bo Wang2,B,C,D,F, Yue Zhou2,A,B,C,D,E,F, Ya-Ping Wang3,B,C,F, Ji-Chao Ding2,B,C,F

1 Department of Radiology, Affiliated Hospital of Dali University, China

2 Department of Histology and Embryology, Dali University, China

3 Department of Histology and Embryology, Chongqing Medical University, China

Abstract

Background. Leukemic stem cells (LSCs) play an important role in the pathogenesis of leukemia. This research attempted to clarify effects of the telomere system on ginsenoside Rg1-induced senescence of LSCs.

Objectives. This research attempted to clarify effects of the telomere system on ginsenoside Rg1-induced senescence of LSCs.

Materials and methods. CD34+CD38 LSCs were isolated, sorted, and divided into a control group and a Rg1 group (treated with 40 μmol/L Rg1). Cell Counting Kit-8 (CCK-8) was used to evaluate cell proliferation, and flow cytometry was used to assess the cell cycle of CD34+CD38 LSCs. The senescence-associated β-galactosidase (SA-β-Gal) staining and CFU-Mix assay were conducted to measure senescence of CD34+CD38 LSCs. The mRNA transcription and protein expression of p16INK4a and human telomerase reverse transcriptase (hTERT) were determined using a real-time polymerase chain reaction (RT-PCR) and western blot assay, respectively.

Results. The Rg1 treatment significantly attenuated proliferative activity and decreased the proliferative index (PI) of CD34+CD38 LSCs compared to those of the control group (p < 0.05). It remarkably increased positive SA-β-Gal staining rate, and suppressed formation of the CFU-Mix of CD34+CD38 LSCs compared with those of the control group (p < 0.05). The Rg1 treatment markedly boosted telomere effector, p16INK4a, in CD34+CD38 LSCs compared with that of control group (p < 0.05). Such treatment obviously reduced telomere regulator, hTERT, in CD34+CD38 LSCs compared with the control group (p < 0.05).

Conclusions. Ginsenoside Rg1-induced senescence of CD34+CD38 LSCs through upregulating p16INK4a and downregulating hTERT expression, both of which are associated with telomere systems. The present study would be beneficial for the treatment of leukemia by providing a promising strategy to induce senescence of CD34+CD38 LSCs.

Key words: senescence, telomere, ginsenoside Rg1, leukemic stem cells

Background

Leukemic stem cells (LSCs), important pathogenic factors of leukemia, play an important role in the initiation of leukemia.1, 2 The clinical recurrence or relapse of leukemia is correlated with decreased therapeutic response for LSCs.3 Strong resistance of LSCs to traditional, cell cycle-dependent drugs, it leads to a poor therapeutic effect, easy recurrence and drug resistance.4 Drug resistance has become a difficult problem in the treatment of leukemia.5 Therefore, it will be a breakthrough in the treatment of leukemia to find drugs that can specifically target LSCs and effectively inhibit the proliferation of LSCs without damaging normal tissue cells.

Cell aging or senescence is closely related to a tumor and is considered to be one of the mechanisms of tumor self-inhibition.6 Therefore, inducing tumor cell senescence is considered to be an effective way to treat cancer. The CD34+CD38 LSCs are the first identified LSCs; therefore, their inhibition might be beneficial to the cell senescence of tumor cells in leukemia patients.7, 8 Ginsenoside Rg1 (shorter: Rg1) is an important pharmacological active component of Panax ginseng and functions as an anti-tumor agent by promoting the proliferation of blood cells.9 It can effectively promote the proliferation of normal hematopoietic stem/progenitor cells in the blood system and delay their aging.10 Moreover, Rg1 can inhibit the proliferation and induce the senescence of leukemia K562 cells within an abnormal blood system.11

The human telomerase reverse transcriptase (hTERT) is an important catalytic component for regulating telomerase activity and, therefore, could be effective in inhibiting telomerase activity, thereby preventing the progression of the cell cycle, and suppressing tumor growth.12, 13 The p16INK4A is considered to be a cyclin-dependent kinase inhibitor illustrating many biological functions, such as inhibition of the cell cycle.14, 15 Therefore, we speculated that hTERT and p16INK4A might be involved in the aging or senescence of the LSC, and furthermore, participate in tumor growth.

Objectives

In this study, Rg1 was applied to the CD34+CD38 LSCs, and the Rg1-induced targeted regulation and mechanism in CD34+CD38 LSCs were discussed. This study provides an experimental basis for the application of aging, promotes novel research methods in cancer treatment and provides new ideas for the research of leukemia balanced utilizing effective components of natural drugs.

Materials and methods

Experiment grouping

According to the previous study by our team,1 the CD34+CD38 LSCs were successfully sorted and identified by staining with an allophycocyanine (APC)-labeled anti-CD38 antibody and a FITC-labeled anti-CD34 antibody. Therefore, the formerly sorted CD34+CD38 LSCs were used in this study.

In our present research, the CD34+CD38 LSCs were grouped into a control group and a Rg1 group (subdivided into 20 μmol/L, 40 μmol/L and 80 μmol/L groups). In the control group, the CD34+CD38 LSCs were cultured in the Iscove’s modified Dulbecco’s medium (IMDM; Gibco, Grand Island, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) and 5% CO2 at 37°C for 48 h. In the Rg1 group, the CD34+CD38 LSCs were cultured as those in the control group, but also treated with Rg1 (dissolved in dimethyl sulfoxide (DMSO)) for 48 h at final dosages of 20 μmol/L, 40 μmol/L and 80 μmol/L. Moreover, an equal volume of DMSO was also added to the cell medium of the control group. The ginsenoside Rg1, with purity of more than 95% (Cat. No. 060427), was purchased from Jinlin Hongjiu Biotech (Changchun, China).

Measurement for proliferative activity
with CCK-8 assay

The proliferative activity for the CD34+CD38 LSCs was measured with the Cell Counting Kit-8 (CCK-8) method using a commercial CCK-8 Kit (Cat. No. C0037; Beyotime, Shanghai, China), and introduced protocol of the manufacturer. In short, the density of cells was adjusted to 1 × 108 cells per well (96-well plates) and cultured for 48 h at conditions of 5% CO2 and 37°C. Then, the above cells were incubated with the CCK-8 reagent at a final dosage of 20 μL/well for 2 h. Optical density (OD) values for the cells in 96-well plates were determined with a professional enzyme-linked immunosorbent assay (ELISA) reader (ELx808; Bio-Tek, Winooski, USA) at 450 nm. The cell proliferation inhibitive rate (%) calculation was described in our previous study.1

Evaluation for cell cycle
with flow cytometry assay

The CD34+CD38 LSCs were cultured, harvested, washed using phosphate-buffered saline (PBS), fixed with 70% ethanol (cold), and incubated with bovine pancreatic ribonuclease (1 mg/mL medium; Sigma-Aldrich, St. Louis, USA), as described in our previous study.16 The CD34+CD38 LSCs were stained using propidium-iodide (with a dosage of 50 μg/mL) for 30 min in the dark, and then analyzed with a flow cytometer (FACS Aria IIU; Becton Dickinson Biosciences, Oxford, UK). Finally, the cell cycle was analyzed with the Multi-Cycle software (Phoenix, Tokyo, Japan).

Colony formation assay

In the present study, the colony formation assay was carried out as described in previous studies, with some modifications.1, 17 Briefly, the CD34+CD38 LSCs were seeded onto 96-well plates, cultured and incubated with methylcellulose (final concentration of 0.8%; Sigma-Aldrich) with 5% CO2 at 37°C for 2 weeks. A total of 50 or more colony formation units (CFU) of cells were defined as 1 mixed CFU (CFU-Mix). The formed CFU-Mix was counted with a light microscope (BX51; Olympus Corp., Tokyo, Japan).

Determination for senescence
with SA-β-Gal staining

The senescence-associated β-galactosidase (SA-β-Gal) staining was conducted as reported in our previous study.12 The SA-β-Gal staining was carried out according to the protocol of the SA-β-Gal Staining Kit (Cell Signaling Technology, Beverly, USA). In short, the cells were stained with the SA-β-Gal reagent, seeded on slices, and sealed using 70% glycerol (Sigma-Aldrich). Eventually, slices carrying 400 or more LSCs were selected, and the positive-staining LSCs were counted under the inverted microscope.

Evaluation for p16INK4a and hTERT expression using western blot assay

Total protein in CD34+CD38 LSCs was extracted with the protein lysate buffer (Applygen Tech. Inc., Beijing, China). Concentrations for the total proteins were evaluated using the BCA Protein Detection Kit (Cat. No. P0010S; Beyotime) according to the protocol of the manufacturer. The same dosage of proteins was separated with the SDS-PAGE and transferred onto a polyvinylidene difluoride (PVDF) membrane (Beyotime), and then incubated using 5% skimmed milk. The PVDF membrane was incubated with rabbit anti-human p16INK4a antibody (Cat. No. ab108349), rabbit anti-human hTERT antibody (Cat. No. ab32020) and rabbit anti-human GAPDH antibody (Cat. No. ab8245) at 4°C overnight. Subsequently, the PVDF membranes were washed using phosphate-buffered saline with Tween (PBST) buffer and incubated with the horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibody (Cat. No. ab6721) at room temperature for 1.5 h. All of the above antibodies were purchased form Abcam (Cambridge, USA). The bands in the PVDF membranes were visualized using the enhanced ECL Western Blotting Substrate (Cat. No. 32106; Thermo Fisher Scientific, Rockford, USA) and analyzed with the Gel Imaging System GelDoc It TS2L (Bio-Rad, Hercules, USA).

Evaluation for p16INK4a and hTERT mRNA transcription with RT-PCR assay

The cells were lysed using TRIzol solution, and total RNAs were extracted and reversely transcribed to the complementary DNA (cDNAs) under the following conditions: 42°C for 30 min, 99°C for 5 min and 5°C for 5 min. The mRNA transcriptions of p16INK4a, hTERT and GAPDH were amplified using a real-time polymerase chain reaction (RT-PCR) assay, under the following conditions: 95°C for 2 min, 40 cycles of 95°C for 15 s, 60°C for 1 min, and termination at 72°C for 10 min. Here, the GAPDH was defined as the internal control for amplifying hTERT mRNA, and actin was defined as the internal control for amplifying p16INK4a. The primers for amplifying the above targeting genes are illustrated in Table 1. The RT-PCR data were analyzed with the previous reported 2−ΔCt method.18

Statistical analyses

Data are presented as mean ± standard deviation (SD) and analyzed using IBM SPSS v. 19.0 (IBM Corp., Armonk, USA). Data were analyzed using a one-way analysis of variance (ANOVA) test followed by Tukey’s post hoc test for comparing the differences between the groups. A p-value less than 0.05 was defined as a statistically significant.

Results

Rg1 treatment attenuated proliferative activity of CD34+CD38 LSCs

The CCK-8 assay findings showed that the Rg1 treatment (all dosages of 20 μmol/L, 40 μmol/L and 80 μmol/L) significantly attenuated the proliferative activity compared with the control group (Table 2, all p < 0.05). The inhibitive rates of CD34+CD38 LSCs were increased with increases in Rg1 treatment concentrations, with an obvious Rg1 concentration-dependent manner. The condition of the 40 μmol/L Rg1 treatment for 48 h (with an inhibitive rate of 52.01%), demonstrated a half-proliferation inhibition. Therefore, the regimen of 40 μmol/L Rg1 for 48 h in treating CD34+CD38 LSCs was used for the following experiments and tests (in the Rg1 group).

Rg1 treatment decreased proliferative index (PI) of CD34+CD38 LSCs

The cell cycle findings indicated that CD34+CD38 LSCs in the G0/G1 phase were remarkably increased, and in the G2/M phase and S phase were significantly decreased in the Rg1 group compared with the control group (Table 3, all p < 0.05). Through calculating the cell amounts in G0/G1, G2/M and S phases, we found that the Rg1 treatment markedly decreased the proliferative index (PI) compared with the control group (Table 3, p < 0.05).

Rg1 treatment raised positive SA-β-Gal staining rate of CD34+CD38 LSCs

According to the SA-β-Gal staining images, there were obviously SA-β-Gal-stained CD34+CD38 LSCs in the Rg1 group, with no obvious staining in the control group (Figure 1A). The statistical analysis illustrated that the SA-β-Gal staining rate in the Rg1 group (44.74%) was significantly higher compared with the control group (12.03%) (Figure 1B, p < 0.05).

Rg1 treatment suppressed formation of CFU-Mix of CD34+CD38 LSCs

As a marker for cell aging, CFU-Mix, is also observed in the CD34+CD38 LSCs (Figure 2A).19 The results exhibited that the Rg1 treatment markedly suppressed the formation of the CFU-Mix of CD34+CD38 LSCs compared with the control group (Figure 2B, p < 0.05).

Rg1 treatment boosted telomere effector, p16INK4a, in CD34+CD38 LSCs

The telomere damage system associated effector, p16INK4a was also determined using both a RT-PCR assay (Figure 3) and a western blot assay (Figure 4A).20 The findings showed that the Rg1 treatment obviously boosted both p16INK4a mRNA transcription (Figure 3) and p16INK4a protein expression (Figure 4B) in CD34+CD38 LSCs compared with the control group (p < 0.05). These results suggest that CD34+CD38 LSCs undergoing Rg1 treatment demonstrate obvious aging characteristics of stem cells.

Rg1 treatment reduced telomere regulatory biomarker, hTERT, in CD34+CD38 LSCs

The telomere regulatory biomarker, hTERT,21 was evaluated using a RT-PCR (Figure 3) and a western blot assay (Figure 5A). As the results demonstrated, Rg1 treatment remarkably reduced the hTERT mRNA transcription (Figure 3) and hTERT protein expression (Figure 5B) when compared with the control group (p < 0.05). These results imply that CD34+CD38 LSCs undergoing Rg1 treatment indirectly attenuate telomere activity by reducing hTERT expression.

Discussion

The LSCs have been proven as a risk factor for acute myeloid leukemia (AML) and are associated with chemotherapy resistance and relapse of disease.22, 23 Therefore, discovering a novel reagent or drug targeting LSCs might hold promise for the clinical treatment of AML. According to former studies,24, 25 Traditional Chinese medicine (TCM) normally demonstrates drug acceptance when applied in the disease therapy. Therefore, we speculated that TCM might play a feasible role in treating the senescence of CD34+CD38 LSCs in certain signaling pathways.

Ginsenoside Rg1, in TCM, could benefit the Qi and nourish the blood, as described by Chinese medicine theory,26 as well as protect against injury, aging and oxidants, and promote immunity, as described by modern medicine theory.27 Many reports have documented and proved the anti-senescence function of Rg1 through different pathways, including activating the SIRT1/TSC2 signaling pathway,1 the SIRT3/SOD2 signaling pathway16 and the SIRT6/NF-kB signaling pathway,15 all of which target CD34+CD38 LSCs. In this study, we clarified a novel signaling pathway that promotes the effects of Rg1 on senescence of CD34+CD38 LSCs.

We found that Rg1 treatment remarkably attenuated CD34+CD38 LSCs proliferation and obviously decreased proliferative index (PI) by modulating cell cycle, which is consistent with the findings of previous studies.1, 28 Therefore, the Rg1 significantly inhibits the proliferation and blocks the cell cycle of CD34+CD38 LSCs. The previous study29 reported that SA-β-Gal staining could reflect the senescence of CD34+CD38 LSCs. Our results indicated that Rg1 treatment increased the positive SA-β-Gal staining rate of CD34+CD38 LSCs and suppressed the formation of the CFU-Mix of CD34+CD38 LSCs. These results suggest that Rg1 inhibits the CFU-Mix formation and senescence of CD34+CD38 LSCs, which is consistent with the previous study.1

The activation of the telomerase could protect against telomere damage by delaying the senescence of cells and mediating the apoptosis.30 Therefore, the status of telomere might be correlated with the senescence of cells. The p16 plays a critical role in the telomere damage-associated senescence by limiting the apoptosis.31 Meanwhile, the telomerase reverse transcriptase (TERT) modulates the telomere-associated senescence by triggering the DNA-damage response of cells.32 Previous research33, 34 also documents that ginsenoside Rg1 could ameliorate proliferation of hematopoietic progenitor cells/hematopoietic stem cells (HPCs/HSCs) through reducing the expression of p16INK4a. Therefore, in the present study, expressions of both telomere damage system-associated effector (p16INK4a)20 and telomere regulatory biomarker (hTERT)21 in CD34+CD38 LSCs administrated with Rg1 were determined. Our findings illustrated that Rg1 treatment boosted p16INK4a expression and reduced hTERT expression in the CD34+CD38 LSCs. These results suggest that Rg1 triggers the senescence of CD34+CD38 LSCs via upregulating p16INK4a expression and downregulating hTERT expression.

Limitations

In this study, whether ginsenoside Rg1 plays role in Rg1-triggered enhancive effects on CD34+CD38 LSCs growth have not been clarified, which is a limitation of this study.

Conclusions

Our findings indicate that Rg1 could suppress proliferation and decrease the proliferative index of CD34+CD38 LSCs. Ginsenoside Rg1 demonstrated positive SA-β-Gal staining and inhibited formation of the CFU-Mix, both of which are indicators for senescence of cells. Also, Rg1 boosted p16INK4a expression and reduced hTERT expression in CD34+CD38 LSCs. In summary, ginsenoside Rg1 induces the senescence of CD34+CD38 LSCs through upregulating p16INK4a expression and downregulating hTERT expression, both of which are associated with the telomere system. The present study would be beneficial in the treatment of AML by providing a promising strategy to induce senescence of CD34+CD38 LSCs.

Tables


Table 1. The specific primers for the PCR assay

Primers

Sense (5’-3’)

Anti-sense (5’-3’)

Length [bp]

p16INK4a

AAGACATCGTGCGATATTTGCG

TGAGCTGAAGCTATGCCCGTC

121

β-actin

TGACGTGGACATCCGCAAAG

CTGGAAGGTGGACAGCGAGG

205

hTERT

TTGGAATCAGACAGCACTTG

GTAGTCCATGTTCACAATCG

155

GADPH

AGATCCCTCCAAAATCAAGTGG

GGCAGAGATGATGACCCTTTT

130

Table 2. Inhibiting rate of Rg1 on proliferation of CD34+CD38– LSCs in vitro (±SD, n = 8)

Groups

Dosage [μmol/L]

Inhibitive rate [%]

24 h

48 h

72 h

Control

1.57 ±0.24

5.68 ±0.36

12.47 ±1.21

Rg1

20

13.63 ±1.02*

24.16 ±1.21*

31.44 ±2.02*

Rg1

40

28.13 ±1.44*,#

52.01 ±2.14*,#

62.47 ±2.03*,#

Rg1

80

38.76 ±2.01*

64.46 ±3.12*

76.04 ±0.92*,Δ

*p < 0.05 compared to the control group; #p < 0.05 compared to the 20 μmol/L group; Δp < 0.05 compared to the 40 μmol/L group.
Table 3. Effect of Rg1 on distribution of cell cycle to CD34+CD38− LSCs (±SD, n = 8)

Groups

Dosage [μmol/L]

G0/G1 phase [%]

G2/M phase [%]

S phase [%]

PI

Control

70.35 ±5.02

17.24 ±2.12

12.41 ±1.35

29.65 ±1.06

Rg1

40

86.89 ±4.32*

6.12 ±1.03*

6.99 ±1.06*

13.11 ±1.17*

*p < 0.05 compared to the control group.

Figures


Fig. 1. SA-β-Gal staining for the CD34+CD38− LSCs (± SD, n = 8). A. Negative SA-β-Gal staining of cells in control group; B. Positive SA-β-Gal staining of cells in Rg1 group. Black arrow represents the positive SA-β-Gal staining cells; ×400 magnification; *p < 0.05 compared to the control group
Fig. 2. Effects of Rg1 on the colony formation of CFU-Mix of CD34+CD38− LSCs (± SD, n = 8). A. CFU-Mix formation in control group; B. CFU-Mix formation in Rg1 group; *p < 0.05 compared to the control group
Fig. 3. Effects of the Rg1 on the p16INK4a mRNA transcription and hTERT mRNA transcription in CD34+CD38− LSCs (± SD, n = 8). The mRNA transcriptions were determined using the RT-PCR assay; *p < 0.05 compared to the control group
Fig. 4. Effects of Rg1 on the p16INK4a protein expression in CD34+CD38− LSCs (± SD, n = 8). A. Western blot image of the p16INK4a protein expression; B. Rg1 treatment increased p16INK4a protein expression; *p < 0.05 compared to the control group
Fig. 5. Effects of Rg1 on the hTERT protein expression in CD34+CD38− LSCs (± SD, n = 8). A. Western blot image of the hTERT protein expression; B. Rg1 treatment decreased hTERT protein expression; *p < 0.05 compared to the control group

References (34)

  1. Tang YL, Zhang CG, Liu H, et al. Ginsenoside Rg1 inhibits cell proliferation and induces markers of cell senescence in CD34+CD38– leukemia stem cells derived from KG1-alpha acute myeloid leukemia cells by activating the Sirtuin 1 (SIRT1)/tuberous sclerosis complex 2 (TSC2) signaling pathway. Med Sci Monit. 2020;26:e918207. doi:10.12659/MSM.918207
  2. Wawrzyniak-Dzierzek E, Gajek K, Slezak A, et al. Pediatric unmanipulated haploidentical hematopoietic stem cell transplantation with post-transplant cyclophosphamide and reduced intensity, TBI-free conditoning regimens in salvage transplantations. Adv Clin Exp Med. 2019;28(9):1223–1228. doi:10.17219/acem/104688
  3. Siveen KS, Uddin S, Mohammad RM. Targeting acute myeloid leukemia stem cell signaling by natural products. Mol Cancer. 2017;16(1):13. doi:10.1186/s12943-016-0571-x
  4. Riether C, Schurch CM, Flury C, et al. Tyrosine kinase inhibitor-induced CD70 expression mediates drug resistance in leukemia stem cells by activating Wnt signaling. Sci Transl Med. 2015;7(298):298ra119. doi:10.1126/scitranslmed.aab1740
  5. Cucchi DGJ, Bachas C, van den Heuvel-Eibrink MM, et al. Harnessing gene expression profiles for the identification of ex vivo drug response genes in pediatric acute myeloid leukemia. Cancers (Basel). 2020;12(5):E1247. doi:10.3390/cancers12051247
  6. Hu X, Zhang H. Doxorubicin-induced cancer cell senescence shows a time delay effect and is inhibited by epithelial-mesenchymal transition (EMT). Med Sci Monit. 2019;25(1):3617–3623. doi:10.12659/MSM.914295
  7. Strickland SA, Mohan SR, Savona MR. Unfavorable-risk acute myeloid leukemia dissected. Curr Opin Hematol. 2016;23(2):144–149. doi:10.1097/MOH.0000000000000225
  8. Navarrete-Reyes AP, Soto-Perez-de-Celis E, Hurria A. Cancer and ageing: A complex biological association. Rev Invest Clin. 2016;68(1):17–24. PMID:27028173
  9. Chu SF, Zhang JT. New achievements in ginseng research and its future prospects. Chin J Integr Med. 2009;15(6):403–408. doi:10.1007/s11655-009-0403-6
  10. Chen C, Mu XY, Zhou Y, et al. Ginsenoside Rg1 enhances the resistance of hematopoietic stem/progenitor cells to radiation-induced aging in mice. Acta Pharmacol Sin. 2014;35(1):143–150. doi:10.1038/aps.2013.136
  11. Chen X, Zhang J, Fang Y, Zhao C, Zhu Y. Ginsenoside Rg1 delays tert-butyl hydroperoxide-induced premature senescence in human WI-38 diploid fibroblast cells. J Gerontol A Biol Sci Med Sci. 2008;63(3):253–264. doi:10.1093/gerona/63.3.253
  12. Cohen SB, Graham ME, Lovrecz GO, Bache N, Robinson PJ, Reddel RR. Protein composition of catalytically active human telomerase from immortal cells. Science. 2007;315(5820):1850–1853. doi:10.1126/science.1138596
  13. George J, Banik NL, Ray SK. Knockdown of hTERT and concurrent treatment with interferon-gamma inhibited proliferation and invasion of human glioblastoma cell lines. Int J Biochem Cell Biol. 2010;42(7):1164–1173. doi:10.1016/j.biocel.2010.04.002
  14. Zhang CY, Bao W, Wang LH. Downregulation of p16 (ink4a) inhibits cell proliferation and induces G1 cell cycle arrest in cervical cancer cells. Int J Mol Med. 2014;33(6):1577–1585. doi:10.3892/ijmm.2014.1731
  15. Yang X, Sun Y, Li H, et al. C-terminal binding protein-2 promotes cells proliferation and migration in breast cancer via suppression of p16INK4A. Oncotarget. 2017;8(16):26154–26168. doi:10.18632/oncotarget.15402
  16. Zhou Y, Wang YP, He YH, Ding JC. Ginsenoside Rg1 performs anti-aging functions by suppressing mitochondrial pathway-mediated apoptosis and activating sirtuin 3 (SIRT3)/superoxide dismutase 2 (SOD2) pathway in Sca-1+ HSC/HPC cells of an aging rat model. Med Sci Monit. 2020;26:e920666. doi:10.12659/MSM.920666
  17. Xu B, Wang S, Li R, et al. Disulfiram/copper selectively eradicates AML leukemia stem cells in vitro and in vivo by simultaneous induction of ROS-JNK and inhibition of NF-kB and Nrf 2. Cell Death Dis. 2017;8:e2797. doi:10.1038/cddis.2017.176
  18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(2):402–408. doi:10.1006/meth.2001.1262
  19. Tang YL, Zhou Y, Wang XP, Wang JW, Ding JC. SIRT6/NF-kB signaling axis in ginsenoside Rg1-delayed hematopoietic stem/progenitor cell senescence. Int J Clin Exp Pathol. 2015;8(5):5591–5596. PMID:26191269
  20. Jacobs JJ, de Lange T. p16INK4a as a second effector of the telomere damage pathway. Cell Cycle. 2005;4(10):1364–1368. doi:10.4161/cc.4.10.2104
  21. Yuan X, Xu D. Telomere reverse transcription (TERT) in action: Cross-talking with epigenetics. Int J Mol Sci. 2019;20(13):3338. doi:10.3390/ijms20133338
  22. Gluexam T, Grandits AM, Schlerka A, et al. CGRP signaling via CALCRL increases chemotherapy resistance and stem cell properties in acute myeloid leukemia. Int J Mol Sci. 2019;20(23):5826. doi:10.3390/ijms20235826
  23. Li H, Guo L, Jie S, et al. Berberine inhibits SDF-1-induced AML cells and leukemic stem cells migration via regulation of SDF-1 level in bone marrow stromal cells. Biomed Pharmacother. 2008;62(9):573–678. doi:10.1016/j.biopha.2008.08.003
  24. Lou JS, Yao P, Tsim KWK. Cancer treatment by using Traditional Chinese Medicine: Probing acute compounds in anti-multidrug resistance during drug therapy. Curr Med Chem. 2018;25(38):5128–5141. doi:10.2174/0929867324666170920161922
  25. Lin Z, Chen B, Wu T, Xu X. Highly tumorigenic diffuse large B cell lymphoma cells are produced by coculture with stromal cells. Acta Haematol. 2018;139(4):201–216. doi:10.1159/000488385
  26. Qi R, Jiang R, Xiao H, et al. Ginsenoside Rg1 protects against d-galactose induced fatty liver disease in a mouse model via FOXO1 transcription factor. Life Sci. 2020;254(1):117776. doi:10.1016/j.lfs.2020.117776
  27. Xiong W, Li J, Jiang R, Li D, Liu Z, Chen D. Research on the effect of ginseng polysaccharide on apoptosis and cell cycle of human leukemia cell line K562 and its molecular mechanisms. Exp Ther Med. 2017;13(3):924–934. doi:10.3892/etm.2017.4087
  28. Lahiani MH, Eassa S, Parnell C, et al. Carbon nanotubes as carriers of Panax ginseng metabolites and enhancers of ginsenosides Rb 1 and Rg1 anti-cancer activity. Nanotechnology. 2017;28(1):015101. doi:10.1088/0957-4484/28/1/015101
  29. Tominaga T, Shimada R, Okada Y, Kawamata T, Kibayashi K. Senescence-associated-beta-galactosidase staining following traumatic brain injury in the mouse cerebrum. PLoS One. 2019;14(3):e0213673. doi:10.1371/journal.pone.0213673
  30. Panneer Selvam S, Roth BM, Nganga R, et al. Balance between senescence and apoptosis is regulated by telomere damage-induced associated between p16 and caspase-3. J Biol Chem. 2018;293(25):9784–9800. doi:10.1074/jbc.RA118.003506
  31. Lou C, Deng A, Zheng H, et al. Pinitol suppresses TNF-alpha-induced chondrocyte senescence. Cytokine. 2020;130:155047. doi:10.1016/j.cyto.2020.155047
  32. Ling X, Yang W, Zou P, et al. TERT regulates telomere-related senescence and apoptosis through DNA damage response in male germ cells exposed to BPDE in vitro and to B [a]P in vivo. Environ Pollut. 2018;235:836–849. doi:10.1016/j.envpol.2017.12.099
  33. Wang ZL, Chen LB, Qiu Z, et al. Ginsenoside Rg1 ameliorates testicular senescence changes in D gal induced aging mice via anti-inflammatory and antioxidative mechanisms. Mol Med Rep. 2018;17:6269–6276. doi:10.3892/mmr.2018.8659
  34. Cai SZ, Zhou Y, Liu J, et al. Alleviation of ginsenoside Rg1 on hematopoietic homeostasis defects caused by lead-acetate. Biomed Pharmacother. 2018;97:1204–1211. doi:10.1016/j.biopha.2017.10.148