From discovery to implementation

Advances in Clinical and Experimental Medicine

Title abbreviation: Adv Clin Exp Med
Journal Impact Factor (JIF 2025) – 2.5
Journal Citation Indicator (JCI 2025) – 0.40
Scopus CiteScore (2025) – 4.2
Index Copernicus Value (ICV 2024) – 161.00
MNiSW – 70 pts
ISSN 1899–5276 (print), ISSN 2451-2680 (online)
Periodicity – monthly

Download original text (EN)

Advances in Clinical and Experimental Medicine

Ahead of print

doi: 10.17219/acem/186335

Publication type: original article

Language: English

License: Creative Commons Attribution 3.0 Unported (CC BY 3.0)

Download citation:

  • BIBTEX (JabRef, Mendeley)
  • RIS (Papers, Reference Manager, RefWorks, Zotero)

Cite as:


Zarobkiewicz MK, Lehman N, Kowalska W, Dąbrowska I, Bojarska-Junak A. Expression of CD226 on γδ T cells is lower in advanced chronic lymphocytic leukemia and correlates with IgA, IgG and LDH levels [published online as ahead of print on May 31, 2024]. Adv Clin Exp Med. 2025. doi:10.17219/acem/186335

Expression of CD226 on γδ T cells is lower in advanced chronic lymphocytic leukemia and correlates with IgA, IgG and LDH levels

Michał K. Zarobkiewicz1,A,B,C,D, Natalia Lehman1,B,F, Wioleta Kowalska1,B,E,F, Izabela Dąbrowska2,B,E,F, Agnieszka Bojarska-Junak1,A,D,E,F

1 Department of Clinical Immunology, Medical University of Lublin, Poland

2 Department of Interventional Radiology and Neuroradiology, Medical University of Lublin, Poland

Graphical abstract


Graphical abstracts

Abstract

Background. Gamma-delta (γδ) T cells comprise an important subset of human T cells, responding to viral and bacterial infections, and are significant for cancer immunosurveillance. Human γδ T cells are divided into 5 major subsets, namely Vδ1–Vδ5, of which the latter 3 have limited available literature. At present, Vδ2 is the most studied subpopulation.

Objectives. In the current paper, we focused on non-Vδ2 cells in chronic lymphocytic leukemia (CLL). We assessed the expression of co-inhibitory checkpoint receptors (CTLA-4, PD-1 and TIGIT) and co-stimulatory (CD226 and NKp30) molecules separately on Vδ1 and Vδ3–Vδ5 cells.

Materials and methods. We assessed γδ T cells for their expression of both cytotoxicity-related (NKp30, CD226) and co-inhibitory (PD-1, TIGIT) molecules with flow cytometry in CLL patients. Moreover, we evaluated the expression of TIGIT and CD226 ligand (PVR , CD155) in neoplastic B cells in CLL patients with quantitative real-time polymerase chain reaction (qPCR).

Results. A significant accumulation of Vδ1 T cells was noted, while no difference was observed in the total percentage of Vδ2 cells. Contrary to our initial hypothesis, the impact of CLL burden on CD226 and TIGIT expression was lower than anticipated. The former tends to be lower in more advanced disease. Finally, a strong upregulation of CD155 (PVR) was noted on CLL-derived B cells when compared to healthy B cells.

Conclusions. Chronic lymphocytic leukemia regulates the expression of the CD155-CD226/TIGIT axis. Contrary to expectations, the ligand is significantly more affected than the receptors. Nevertheless, the relatively high expression of CD155 and TIGIT makes CLL an interesting target for anti-TIGIT immunotherapy.

Key words: CLL, Vδ1, chronic lymphocytic leukemia, Vδ3–Vδ5, γδ T

Background

Chronic lymphocytic leukemia (CLL) is an indolent leukemia derived from mature B cells.1 It is mainly diagnosed in older adults and is the most common adult leukemia.2, 3 However, despite significant progress, it remains incurable.4 Thus, patients are commonly observed, and treatment is initiated only after certain conditions are fulfilled.4 Furthermore, CLL is associated with a high tumor burden as neoplastic B cells can easily comprise >90% of the total peripheral blood mononuclear cells.5 This leads to the creation of a significant immunosuppressive environment and pushes T cells towards exhaustion.6, 7 Exhausted T cells show alterations in their cytokine secretion profiles, low proliferative rates and, most importantly, overexpression of multiple inhibitory receptors on their surfaces (e.g., PD-1, Lag-3, Tim-3, or TIGIT).8 Notably, T cell exhaustion is comprehensively described for αβ T lymphocytes and the Vδ2 subset of human γδ T cells.9

Gamma-delta T cells constitute a major subset of unconventional T cells and are characterized by the expression of TCR γ and δ chains instead of α and β chains. Murine γδ T cells are usually split up into subsets by their Vγ fragment, while human γδ T cells can be divided based on Vδ fragment into Vδ1–Vδ5.10, 11 Vδ2 cells comprise the major subset of circulating γδ T cells and can be easily expanded in vitro with aminobisphosphonates. Therefore, the majority of γδ T cell research is oriented towards the Vδ2 subtype.12, 13 Vδ1 cells constitute the 2nd largest portion of γδ T cells in peripheral blood, but due to more complicated protocols for their expansion, they are far less understood.14 Vδ3, Vδ4 and Vδ5 are virtually unstudied, mostly due to the lack of appropriate monoclonal antibodies that enable easy immunophenotyping or sorting.

Gamma-delta T cells are severely affected by the CLL disease burden.13 However, current data suggest that this applies unequally to different subsets. While Vδ2 cells show signs of exhaustion and are usually almost unresponsive, Vδ1 cells remain highly active in a large portion of CLL patients.9, 15 Indeed, expansion and domination of Vδ1 may have an important positive influence on the course of CLL.13, 15 While the clinical-grade large-scale expansion of autologous Vδ2 lymphocytes currently seems unreachable, there are such attempts with Vδ1 cells.14 Nevertheless, successful immunotherapy with Vδ1 cells requires a better understanding of the impact that CLL has on both γδ T cells as a whole and their non-Vδ2 compartment.

Objectives

The current paper presents the results of immunophenotyping of human non-Vδ2 cells in CLL patients. The study was based on the hypothesis that the immunosuppressive CLL environment would upregulate the expression of co-inhibitory molecules while downregulating the co-stimulatory potential. Finally, we demonstrated that non-Vδ2 cells seem to be mildly affected by CLL, at least in terms of co-inhibitory and co-stimulatory molecule expression.

Materials and methods

Patients and material

A total of 37 treatment-naïve patients diagnosed with CLL were recruited from the Department of Hematooncology and Bone Marrow Transplantation at the Medical University of Lublin (Poland). Disease staging was performed according to the Rai classification.4, 16 An age- and sex-matched control group was recruited from the Department of Interventional Radiology and Neuroradiology at the Medical University of Lublin and consisted of 20 individuals. Peripheral blood mononuclear cells (PBMCs) were obtained by gradient centrifugation in LSM 1077 (PromoCell, Heidelberg, Germany). Clinically important data were obtained from hospital records, including gene deletions in ATM (11q22.3 locus) and TP53 (17p13.1 locus). Table 1 summarizes the basic characteristics of patients and controls.

Immunophenotyping

Peripheral blood mononuclear cells were incubated with a mix of monoclonal antibodies consisting of anti-CD3 APC (BioLegend, San Diego, USA; cat. No. 300439, clone: UCHT1), anti-TCRγδ BV421 (BD Biosciences, Warsaw, Poland; cat. No. 744870, clone: 11F2), anti-Vδ1 FITC (ThermoFisher, Warsaw, Poland; cat. No. TCR2730, clone: TS8.2), anti-Vδ2 PE (BioLegend; cat. No. 331408, clone: B6), anti-CTLA-4 APC-Fire750 (BioLegend; cat. No. 349930, clone: L3D10), anti-PD-1 PE-Cy7 (BD Biosciences, Franklin Lakes, USA; cat. No. 561272, clone: EH12.1), anti-TIGIT BV650 (BD Biosciences; cat. No. 747840, clone: 741182), anti-NKp30 BV785 (BioLegend; cat No. 325230, clone: P30-15), and anti-CD226 BV605 (BD Biosciences; cat. No. 742495, clone: DX11). Fluorescence minus one (FMO) controls were used to set the correct gates for each fluorophore. Samples were acquired on a Cytoflex LX (Beckman Coulter, Warsaw, Poland) and analyzed with FlowJo 10 (BD Biosciences). The percentage of positive cells was a standard measure for each of the markers except for CD226, where mean fluorescence intensity (MFI) was additionally provided due to its high overall expression.

Bioinformatics

Available RNAseq datasets were used to assess the expression of CD226/TIGIT ligands on the surface of neoplastic B cells. The Chronic Lymphocytic Leukemia (Broad, Nature 2015) dataset was queried on cBioPortal.17, 18, 19 The expression of PVR, NECTIN2 and NECTIN3 was assessed in a subset of 157 CLL patients with mRNA expression data. Expression in transcripts-per-million (TPM) was extracted.

qPCR

B cells were isolated magnetically from healthy donors and CLL patients with anti-CD19 microbeads and LS columns (Miltenyi Biotec, Bergisch Gladbach, Germany). Total RNA was isolated with a Blood RNA Mini kit (Qiagen, Hilden, Germany) and reverse transcription was performed with QuantiTect Reverse Transcription Kit (Qiagen). Finally, quantitative real-time polymerase chain reaction (qPCR) was performed with qPCR Master Mix (Promega, Madison, USA) and primers for PVR and GAPDH. Reactions were run with the Applied Biosystems 7300 Real-Time PCR System (Applied Biosystems, Austin, USA). Gene expression was normalized to GAPDH and is presented as 2–ΔCT. Primer sequences:

PVR for.: 5’ GGATATCTGGCTCCGAGTGC 3’

PVR rev.: 5’ CTCCACCTTGCAGGTCACAT 3’

GAPDH for.: 5’ ATCACCATCTTCCAGGAGCG 3’

GAPDH rev.: 5’ TGGACTCCACGACGTACTCA 3’

Statistical analyses

Results were analyzed with GraphPad Prism v. 9 (GraphPad Software, San Diego, USA) and JASP 0.16.3 (Department of Psychological Methods, University of Amsterdam, Netherlands). A Shapiro–Wilk test was used for data distribution analysis. The p-values were calculated with Mann–Whitney U tests, and differences were considered significant when p < 0.05. Data are presented as the median and interquartile range (IQR). Correlations were assessed with a Spearman’s test. In the statistical analysis, we employed an exploratory approach, not including a correction for families of hypotheses, which leads to an increased risk of type 1 error. Thus, the results must be interpreted with caution. The study might serve as a starting point for further research in the field. Detailed p-values for each comparison are presented in Supplementary Table 1.

Results

Vδ1 cells are expanded in CLL patients

First, we assessed the percentage of Vδ1 and Vδ2 T cells. While the percentage of Vδ2 cells seemed unaffected by CLL, Vδ1 lymphocytes were significantly expanded (0.33% in healthy volunteers (HV) compared to 0.98% in the CLL group) (Figure 1A). Vδ3–Vδ5 subset was gated among Vδ1- and Vδ2-negative cells (Figure 1B). Next, we assessed the expression of NKp30 and CD226 on each subset, again without any significant differences (Figure 2, Figure 3). Finally, we assessed the expression of checkpoint molecules on Vδ1 and Vδ3–Vδ5 subsets. No significant differences were noted, except for the downregulation of CTLA-4 on Vδ1 (2.99% in HV compared to 1.67% in CLL) (Figure 4)

CD226 expression is higher in ZAP-70 negative cases

Next, we checked whether CD38 and ZAP-70 status significantly affected the immune parameters we tested. Out of all the markers, only CD226 MFI increased significantly between ZAP-70 positive and negative cases (19,041 compared to 15,058) (Figure 5A). No differences were noted for the remaining parameters (TIGIT, PD-1, CTLA-4, NKp30) (data not shown).

Patients with known deletions have lower CD226 expression on Vδ2 cells

Out of the total group, 8 patients had some identified deletions, being mostly TP53 deletions. Thus, we divided patients into those with and without known deletions. Then, we compared the immunological parameters between those 2 groups. Patients with identified deletions exhibited significantly lower expression of CD226 on Vδ2 cells compared to those without deletions (77.50% compared to 91.60%). (Figure 5A).

The percentage of Vδ1 drops with the disease stage, but the expression of CD226 thereon increases

Rai classification is commonly used for the clinical staging of CLL. Thus, we divided patients into 3 groups: stage 0, stages I–II and stages III–IV. The percentage of Vδ1 trended down with an increase in the disease stage, although this was not significant (Figure 5B). Interestingly, we noted a significant increase in the expression of CD226 on Vδ1 cells (Figure 5B). In contrast, CD226 expression on Vδ2 cells decreased with stage progression (Figure 5B).

CD226/TIGIT ligands expression varies between IGVH mutated and unmutated subjects

Using a publicly available dataset, we assessed the expression of CD226/TIGIT ligands on neoplastic B cells in CLL. Only PVR (CD155) had a notable expression, and both NECTIN2 (CD112) and NECTIN3 (CD113) had negligible expression levels (Figure 6A). PVR expression was also significantly higher in IGVH unmutated subjects, and no differences were observed for the other 2 ligands (Figure 6A). The overexpression of PVR was also confirmed with qPCR in isolated B cells from CLL patients and HV (Figure 6B).

CD226 expression on Vδ2 correlates positively with IgA and IgG levels and negatively with LDH

A moderate positive correlation between CD226 (ρ = 0.63) expression on Vδ1 and Vδ3–Vδ5 was noted, and a similar correlation was observed for PD-1 (ρ = 0.727). CD226 expression on Vδ2 cells correlated moderately with lactate dehydrogenase (LDH) levels (ρ = –0.637), immunoglobulin A (IgA) (ρ = 0.608) and IgG (ρ = 0.573) serum concentrations. Moreover, IgG correlated with NKp30+ Vδ1 (ρ = –0.529), while similarly IgA correlated with TIGIT+ Vδ1 (ρ = 0.6) (Figure 7). For the remaining correlations, the monotonic component of the relationship was not detected, and they are presented in the full matrix of correlations for immunological, hematological and clinical parameters (Supplementary Fig. 1,3).

Discussion

Chronic lymphocytic leukemia, especially a relatively advanced disease, is characterized by an accumulation of highly immunosuppressive cells, e.g., monocytic myeloid-derived suppressor cells (MDSCs) or B regulatory cells (Bregs).20, 21 Such an immunosuppressive environment is believed to promote co-inhibitory checkpoint molecule expression.22 The expression of co-inhibitory and co-stimulatory molecules, e.g., PD-1, on Vδ2 was previously studied in CLL with some significant differences noted.23, 24 Thus, we focused on non-Vδ2 cells, which are currently lacking investigations. Most importantly, we did not observe any significant upregulation of CTLA-4, PD-1 or TIGIT in either Vδ1 or Vδ3–Vδ5 subsets. This suggests that Vδ1 cells may be less affected by the highly immunosuppressive environment of peripheral blood from CLL patients. Indeed, previous observations, e.g., good response to autologous neoplastic B cells, high cytotoxic potential or good in vitro proliferation, seem to confirm this.9, 14, 15 This is in sharp contrast to Vδ2 cells, which tend to be exhausted and dysfunctional in CLL. Moreover, even Vδ2 cells obtained from healthy individuals provide significantly weaker responses to neoplastic B cells.13, 23, 24, 25

CD226, also known as DNAM-1, is an activating receptor important for cytotoxicity of NK and γδ T cells. It competes with TIGIT for its ligands, namely PVR (CD155), CD112 and CD113.26, 27 Reduced expression of CD226 on γδ T cells results in decreased cytotoxic potential in neuroblastoma.8 No differences in CD226 expression were noted for any of the subsets in the current study. This is similar to the observation of CD226 expression on NK cells in CLL.28 While Veuillen et al. argued that CD226 ligands are rarely expressed by neoplastic B cells in CLL,29 contrary results were obtained from RNAseq data analysis, namely, a significantly upregulated expression of PVR (CD155) was noted. TIGIT is a novel checkpoint molecule that was discovered in 2009.30 TIGIT competes with CD226 for their ligands, and studies with blocking antibodies against TIGIT demonstrated that it comprises mostly the Th1-related and cytotoxic response.31 In this study, we noted an insignificant increase in TIGIT expression on non-Vδ2 cells. This is partly comparable to the situation in acute myeloid leukemia (AML) where, on the one hand, TIGIT expression is increased and, on the other, CD226 is decreased.32

Similar to Bartkowiak et al., we observed a significant expansion of Vδ1 in CLL patients,33 whereas we noted only a small and statistically insignificant expansion of Vδ2 cells, which is in line with de Weerdt et al., who also noted an insignificant accumulation of Vδ2.23 Interestingly, despite the drop in Vδ1 percentage in patients with more advanced disease, we observed an increase in CD226 expression on Vδ1. This may suggest that Vδ1 retains at least some of its activity and, hopefully, some of its cytotoxic potential. Almeida et al. proposed an optimized protocol for clinical-grade expansion of Vδ1 cells from CLL patients for further use in in vitro immunotherapy.14 The results of the current study suggest that Vδ1 cells are less affected by the CLL burden than Vδ2 ones, and with such a feasible clinical-grade expansion, they show a real potential for CLL immunotherapy. Vδ1 cells exhibit significant cytotoxicity against leukemic cells and have been observed to persist in the circulation for longer periods than Vδ2 cells.34 Moreover, Vδ1, both from healthy donors and from CLL patients, are significantly more cytotoxic against CLL cells.13, 15

ZAP-70 and CD38 are important prognostic factors in CLL.35 The standard cutoff (as in our study) for positive/negative ZAP-70/CD38 is 20% of positive B cells.35 After such division, we noted a significantly lower expression of CD226 on Vδ2 cells from ZAP-70-positive patients. Moreover, we have also noted a decreasing trend in CD226 expression on Vδ2 in patients with more advanced disease. This suggests that Vδ2 may be more affected by the immunosuppressive environment of CLL than Vδ1. Lactate dehydrogenase level is commonly considered to be a marker of disease burden with an important prognostic value; the higher the LDH level, the more advanced the disease.36, 37 Similarly, both IgA and IgG have prognostic value, and their low serum level is usually associated with an advanced and progressive disease.38, 39 Thus, correlations of LDH, IgA and IgG on one side and CD226 expression on Vδ2 on the other seem to be a reflection of similar changes related to tumor burden and progressing dysfunction of Vδ2 cells. The presence of PVR overexpression, a known CD226/TIGIT-ligand, on neoplastic B cells suggests that the CD226/TIGIT–PVR axis may be a significant target for therapeutic modulations. In addition, since Vδ1 cells appear to be much less susceptible to CLL-induced immunosuppression, Vδ1 immunotherapy could be used together with CD226/TIGIT PVR modulators.

Limitations

The current study has some important limitations. First, the Vδ3–Vδ5 cells were analyzed as a whole due to the lack of appropriate monoclonal antibodies. Specifically, there are no anti-Vδ3, anti-Vδ4 or anti-Vδ5 antibodies available on the market. Moreover, the current study lacks any functional analyses. Due to COVID-19, we were experiencing a decrease in the number of patient samples and patients at more advanced stages of the disease reported to the clinic. Most samples did not allow for cell cultures and functional studies. Finally, as the inter-group comparisons and Spearman’s correlation analysis were pre-planned, we decided to employ no post hoc correction for p-value calculations which may have increased the risk of type I error.

Conclusions

Gamma-delta T cells are a heterogeneous group of T cells. The current study suggests that the non-Vδ2 subset of γδ T cells is less affected by the immunosuppressive environment of CLL than the Vδ2 population. This is further corroborated by previously published results regarding cytotoxicity and activation triggered by CLL-derived B cells.

Supplementary data

The Supplementary materials are available at https://zenodo.org/doi/10.5281/zenodo.10848380. The package includes the following files:

Supplementary Fig. 1. Gating strategy.

Supplementary Fig. 2. The full matrix of correlations.

Supplementary Fig. 3. Scatter plots for each correlation pair.

Supplementary Table 1. Exact p-values for intergroup comparisons.

Data availability

The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

Consent for publication

Not applicable.

Tables


Table 1. Characteristics of patients and controls

Characteristics

Patients

Controls

Number of patients

37

20

Percentage of men

53.38%

61.11%

Age, mean (±SD)

64.46 (±10.73)

65 (±10.58)

Percentage of ZAP-70-positive patients*

23.68%

Percentage of CD38+

26.32%

Percentage of patients with del(17p13.1) or del(11q22.3)

21.62%

Percentage of patients with Rai stage 0 (low-risk)

18.91%

Percentage of patients with Rai stages I–II (intermediate-risk)

43.24%

Percentage of patients with Rai stages III–IV (high-risk)

37.84%

* Leukemic B cells (CD5+/CD19+) were considered positive for ZAP-70 or CD38 expression with a cutoff point of ≥20%. SD – standard deviation.

Figures


Fig. 1. The identification of γδ T subsets along with CD226 and NKp30 expression. Vδ1 and Vδ2 cells were gated among CD3+ lymphocytes (A), while non-Vδ1–Vδ2 were gated from the negative population (non in A) and then gated as TCRγδ+ HV (healthy volunteers) (B)
* p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001.
Fig. 2. CD226 expression on γδ T cells. The gating for CD226 was controlled with FMO (fluorescence minus one) controls (A); results are presented separately for each subset – Vδ1 (B), Vδ2 (C) and non-Vδ1–Vδ2 (D)
HV – healthy volunteers; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001.
Fig. 3. NKp30 expression on γδ T cells. The gating for NKp30 was controlled with FMO (fluorescence minus one) controls (A); results are presented separately for each subset – Vδ1, Vδ2 and non-Vδ1–Vδ2 (B)
HV – healthy volunteers; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001.
Fig. 4. Expression of checkpoint molecules: PD-1 (A), CTLA-4 (B) and TIGIT (C) was assessed using flow cytometry. Gating was set according to the FMO (fluorescence minus one) controls (presented in Supplementary Fig. 1)
HV – healthy volunteers; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001.
Fig. 5. Differences in immunological parameters in patients in high/low risk groups (cutoff point: 20% positive B cells). Each patient was screened for TP53 and ATM deletions; no known deletions means that neither of those genes was affected (A); different stages of disease (B)
* p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001.
Fig. 6. Expression of CD226/TIGIT ligands on chronic lymphocytic leukemia (CLL) B cells was assessed in publicly available RNAseq datasets (A). PVR expression was assessed using real-time quantitative polymerase chain reaction (qPCR) in isolated B cells from CLL patients and healthy volunteers (B). Gene expression was normalized against GAPDH
unmut – unmutated IGVH; mut – mutated IGVH; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001.
Fig. 7. The most significant correlations of immunological parameters. The full matrix of correlations is presented in Supplementary Fig. 1

References (39)

  1. Seifert M, Sellmann L, Bloehdorn J, et al. Cellular origin and pathophysiology of chronic lymphocytic leukemia. J Exp Med. 2012;209(12):2183–2198. doi:10.1084/jem.20120833
  2. Tietsche De Moraes Hungria V, Chiattone C, Pavlovsky M, et al. Epidemiology of hematologic malignancies in real-world settings: Findings from the Hemato-Oncology Latin America Observational Registry Study. J Glob Oncol. 2019;2019:1–19. doi:10.1200/JGO.19.00025
  3. Watson L, Wyld P, Catovsky D. Disease burden of chronic lymphocytic leukaemia within the European Union. Eur J Haematol. 2008;81(4):253–258. doi:10.1111/j.1600-0609.2008.01114.x
  4. Hallek M, Cheson BD, Catovsky D, et al. iwCLL guidelines for diagnosis, indications for treatment, response assessment, and supportive management of CLL. Blood. 2018;131(25):2745–2760. doi:10.1182/blood-2017-09-806398
  5. Wodarz D, Garg N, Komarova NL, et al. Kinetics of CLL cells in tissues and blood during therapy with the BTK inhibitor ibrutinib. Blood. 2014;123(26):4132–4135. doi:10.1182/blood-2014-02-554220
  6. Riches JC, Davies JK, McClanahan F, et al. T cells from CLL patients exhibit features of T-cell exhaustion but retain capacity for cytokine production. Blood. 2013;121(9):1612–1621. doi:10.1182/blood-2012-09-457531
  7. Forconi F, Moss P. Perturbation of the normal immune system in patients with CLL. Blood. 2015;126(5):573–581. doi:10.1182/blood-2015-03-567388
  8. Vlachonikola E, Stamatopoulos K, Chatzidimitriou A. T cells in chronic lymphocytic leukemia: A two-edged sword. Front Immunol. 2021;11:612244. doi:10.3389/fimmu.2020.612244
  9. Simões C, Silva I, Carvalho A, et al. Quantification and phenotypic characterization of peripheral blood Vδ1+ T cells in chronic lymphocytic leukemia and monoclonal B cell lymphocytosis. Cytometry B Clin Cytom. 2019;96(2):164–168. doi:10.1002/cyto.b.21645
  10. Shiromizu CM, Jancic CC. γδ T lymphocytes: An effector cell in autoimmunity and infection. Front Immunol. 2018;9:2389. doi:10.3389/fimmu.2018.02389
  11. Pang DJ, Neves JF, Sumaria N, Pennington DJ. Understanding the complexity of γδ T‐cell subsets in mouse and human. Immunology. 2012;136(3):283–290. doi:10.1111/j.1365-2567.2012.03582.x
  12. Kondo M, Izumi T, Fujieda N, et al. Expansion of human peripheral blood gamma and delta T cells using zoledronate. J Vis Exp. 2011;55:3182. doi:10.3791/3182
  13. Zarobkiewicz MK, Bojarska-Junak AA. The mysterious actor: γδ T lymphocytes in chronic lymphocytic leukaemia (CLL). Cells. 2022;11(4):661. doi:10.3390/cells11040661
  14. Almeida AR, Correia DV, Fernandes-Platzgummer A, et al. Delta one T cells for immunotherapy of chronic lymphocytic leukemia: Clinical-grade expansion/differentiation and preclinical proof of concept. Clin Cancer Res. 2016;22(23):5795–5804. doi:10.1158/1078-0432.CCR-16-0597
  15. Poggi A, Venturino C, Catellani S, et al. Vδ1 T lymphocytes from B-CLL patients recognize ULBP3 expressed on leukemic B cells and up-regulated by trans-retinoic acid. Cancer Res. 2004;64(24):9172–9179. doi:10.1158/0008-5472.CAN-04-2417
  16. Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukemia. Blood. 1975;46(2):219–234. PMID:1139039.
  17. Gao J, Aksoy BA, Dogrusoz U, et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBio portal. Sci Signal. 2013;6(269):pl1. doi:10.1126/scisignal.2004088
  18. Cerami E, Gao J, Dogrusoz U, et al. The cBio cancer genomics portal: An open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012;2(5):401–404. doi:10.1158/2159-8290.CD-12-0095
  19. Landau DA, Tausch E, Taylor-Weiner AN, et al. Mutations driving CLL and their evolution in progression and relapse. Nature. 2015;526(7574):525–530. doi:10.1038/nature15395
  20. Mohr A, Cumin M, Bagacean C, et al. The regulatory capacity of B cells directs the aggressiveness of CLL. Oncoimmunology. 2019;8(3):1554968. doi:10.1080/2162402X.2018.1554968
  21. Zarobkiewicz M, Kowalska W, Chocholska S, et al. High M-MDSC percentage as a negative prognostic factor in chronic lymphocytic leukaemia. Cancers (Basel). 2020;12(9):2614. doi:10.3390/cancers12092614
  22. Annese T, Tamma R, Ribatti D. Update in TIGIT immune-checkpoint role in cancer. Front Oncol. 2022;12:871085. doi:10.3389/fonc.2022.871085
  23. De Weerdt I, Hofland T, Lameris R, et al. Improving CLL Vγ9Vδ2-T-cell fitness for cellular therapy by ex vivo activation and ibrutinib. Blood. 2018;132(21):2260–2272. doi:10.1182/blood-2017-12-822569
  24. Coscia M, Vitale C, Peola S, et al. Dysfunctional Vγ9Vδ2 T cells are negative prognosticators and markers of dysregulated mevalonate pathway activity in chronic lymphocytic leukemia cells. Blood. 2012;120(16):3271–3279. doi:10.1182/blood-2012-03-417519
  25. Tokuyama H, Hagi T, Mattarollo SR, et al. Vγ9Vδ2 T cell cytotoxicity against tumor cells is enhanced by monoclonal antibody drugs: Rituximab and trastuzumab. Int J Cancer. 2008;122(11):2526–2534. doi:10.1002/ijc.23365
  26. Pende D, Bottino C, Castriconi R, et al. PVR (CD155) and Nectin-2 (CD112) as ligands of the human DNAM-1 (CD226) activating receptor: Involvement in tumor cell lysis. Mol Immunol. 2005;42(4):463–469. doi:10.1016/j.molimm.2004.07.028
  27. Yeo J, Ko M, Lee DH, Park Y, Jin HS. TIGIT/CD226 axis regulates anti-tumor immunity. Pharmaceuticals (Basel). 2021;14(3):200. doi:10.3390/ph14030200
  28. Wang X, Mou W, Han W, et al. Diminished cytolytic activity of γδ T cells with reduced DNAM-1 expression in neuroblastoma patients. Clin Immunol. 2019;203:63–71. doi:10.1016/j.clim.2019.04.006
  29. Veuillen C, Rey J, Castellano R, et al. Defective triggering of NK cells results in primary CLL cells resistance to cytotoxicity. Blood. 2011;118(21):3876. doi:10.1182/blood.V118.21.3876.3876
  30. Yu X, Harden K, C Gonzalez L, et al. The surface protein TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. Nat Immunol. 2009;10(1):48–57. doi:10.1038/ni.1674
  31. Harjunpää H, Guillerey C. TIGIT as an emerging immune checkpoint. Clin Exp Immunol. 2020;200(2):108–119. doi:10.1111/cei.13407
  32. Jin Z, Lan T, Zhao Y, et al. Higher TIGIT +CD226 −γδ T cells in patients with acute myeloid leukemia. Immunol Invest. 2022;51(1):40–50. doi:10.1080/08820139.2020.1806868
  33. Bartkowiak J, Błoński JZ, Niewiadomska H, Kulczycka D, Robak T. Characterization of γδ T cells in peripheral blood from patients with B-cell chronic lymphocytic leukaemia. Biomed Lett. 1998;58(228):19–30.
  34. Lawand M, Déchanet-Merville J, Dieu-Nosjean MC. Key features of gamma-delta T-cell subsets in human diseases and their immunotherapeutic implications. Front Immunol. 2017;8:761. doi:10.3389/fimmu.2017.00761
  35. Hus I, Podhorecka M, Bojarska-Junak A, et al. The clinical significance of ZAP-70 and CD38 expression in B-cell chronic lymphocytic leukaemia. Ann Oncol. 2006;17(4):683–690. doi:10.1093/annonc/mdj120
  36. Autore F, Strati P, Innocenti I, et al. LDH levels predict progression-free survival in treatment-naïve patients with trisomy 12 chronic lymphocytic leukemia. Blood. 2016;128(22):3211. doi:10.1182/blood.V128.22.3211.3211
  37. Hallek M. Chronic lymphocytic leukemia: 2020 update on diagnosis, risk stratification and treatment. Am J Hematol. 2019;94(11):1266–1287. doi:10.1002/ajh.25595
  38. Spaner DE, Venema R, Huang J, et al. Association of blood IgG with tumor necrosis factor-alpha and clinical course of chronic lymphocytic leukemia. EBioMedicine. 2018;35:222–232. doi:10.1016/j.ebiom.2018.08.045
  39. Ishdorj G, Streu E, Lambert P, et al. IgA levels at diagnosis predict for infections, time to treatment, and survival in chronic lymphocytic leukemia. Blood Adv. 2019;3(14):2188–2198. doi:10.1182/bloodadvances.2018026591