Advances in Clinical and Experimental Medicine

Title abbreviation: Adv Clin Exp Med
5-Year IF – 2.0, IF – 1.9, JCI (2024) – 0.43
Scopus CiteScore – 4.3
Q1 in SJR 2025, SJR score – 0.599, H-index: 54 (SJR)
ICV – 161.00; MNiSW – 70 pts
Initial editorial assessment and first decision within 24 h

ISSN 1899–5276 (print), ISSN 2451-2680 (online)
Periodicity – monthly

Download original text (EN)

Advances in Clinical and Experimental Medicine

2025, vol. 34, nr 4, April, p. 623–632

doi: 10.17219/acem/188367

Publication type: original article

Language: English

License: Creative Commons Attribution 3.0 Unported (CC BY 3.0)

Download citation:

  • BIBTEX (JabRef, Mendeley)
  • RIS (Papers, Reference Manager, RefWorks, Zotero)

Cite as:


Huang C, Duan Z, Chen B, Xia H, Wang G. LncRNA LINC00969 modified by METTL3 attenuates papillary thyroid cancer progression in an m6A-dependent manner. Adv Clin Exp Med. 2025;34(4):623–632. doi:10.17219/acem/188367

LncRNA LINC00969 modified by METTL3 attenuates papillary thyroid cancer progression in an m6A-dependent manner

Chaogang Huang1,B,D,F, Ziqi Duan2,A,F, Baojie Chen1,C,F, Hailiang Xia1,E,F, Guangxin Wang1,E,F

1 Department of General Surgery, Wuhan Third Hospital (Tongren Hospital of Wuhan University), China

2 Department of General Surgery, Jianghan University, Wuhan, China

Graphical abstract


Graphical abstracts

Abstract

Background. The long non-coding RNA (lncRNA) LINC00969 is involved in human disease progression, and n6-methyladenosine (m6A) modification of lncRNAs in cancer has been proven to be a key regulatory mechanism. However, our understanding of its effects and mechanisms of action in papillary thyroid carcinoma (PTC) remains limited.

Objectives. This study aimed to elucidate the role of methyltransferase-like 3 (METTL3)-induced m6A modification of LINC00969 in PTC tumorigenesis.

Materials and methods. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to analyze LINC00969 and METTL3 mRNA levels in PTC. The regulation of LINC00969 by METTL3 was confirmed using cell function experiments, molecular biology assays and bioinformatics analysis. LINC00969 stabilization analysis was performed to verify the regulatory roles of METTL3 and LINC00969.

Results. LINC00969 expression was downregulated in PTC tissues. Increased LINC00969 expression inhibited the invasion, growth and migration of PTC cells. METTL3 downregulation in PTC mediated the m6A modification of LINC00969, increasing its stability. Furthermore, METTL3 levels were downregulated in PTC, and its silencing partially reversed the inhibitory effect of LINC00969 overexpression on PTC cell malignancy.

Conclusions. LINC00969 overexpression inhibits PTC cell malignancy via METTL3-mediated m6A modification. These findings suggest that METTL3-m6A-LINC00969 is a promising therapeutic target for PTC.

Key words: papillary thyroid cancer, long non-coding RNA, METTL3, m6A, LINC00969

Background

The incidence of thyroid cancer (THCA), the most common endocrine malignancy, has increased over the past 3 decades.1 Papillary thyroid carcinoma (PTC), the most common subtype of THCA, accounts for 80–85% of all THCA cases.2 Papillary thyroid carcinoma has been documented to exhibit a favorable prognosis, with a 5-year survival rate approaching 100%.3 However, some cases of locally infiltrating PTC have a high recurrence rate.4 In recent years, targeted therapies, particularly small-molecule therapies targeting receptor tyrosine kinases, have been evaluated in clinical trials to improve the survival of patients with PTC presenting with local infiltration.2, 5 Nevertheless, there is a need for further investigation into more valuable molecular targets and mechanisms for the clinical management of PTC.

With the advancement of RNA sequencing technology, scientists are increasingly focusing on a specific class of RNA molecules, namely long non-coding RNAs (lncRNAs), which are over 200 nucleotides in length and do not encode proteins.6 The lncRNAs play crucial roles in diverse biological processes by acting as regulators that interact with RNA, DNA and proteins.7, 8 Studies have shown that lncRNAs regulate carcinogenesis by participating in the invasion, metastasis, differentiation, proliferation, and metabolic reprogramming of tumor cells.9 In PTC, a wide range of lncRNAs are involved in tumor occurrence, including lncRNA GAS8-AS1,10 LINC0067111 and lncRNA ABHD11-AS1.12 LINC00969, also known as the MIR570 host gene, plays inconsistent roles in various human diseases. For instance, LINC00969 accelerates intervertebral disc degeneration by enhancing apoptosis in the nucleus pulposus,13 acts as a potential biomarker for the development of type 2 diabetes mellitus complicated by carotid atherosclerotic plaques,14 and promotes gefitinib resistance in lung cancer cells.15 These studies demonstrate that LINC00969 epigenetically regulates multiple signaling pathways and that epigenetic regulation plays an important role in many biochemical processes associated with human diseases.16 However, the effect of LINC00969 on PTC remains uncertain and requires further investigation.

N6-methyladenosine (m6A) is a class of dynamically reversible RNA modifications in eukaryotic mRNAs that cluster around the stop codon and 3’ untranslated region.17 N6-methyladenosine regulates various cellular pathways and processes by regulating mRNA splicing, expression, decay, and translation.18 There is growing evidence of a potential link between m6A and cancer, with changes in m6A levels affecting the progression or remission of tumors, including lung,19 liver,20 ovarian,21 and breast22 cancers. Methyltransferase-like 3 (METTL3), possessing methyltransferase activity, regulates the progression of multiple tumors, including PTC.23 For example, METTL3 is reported to be downregulated in PTC and to positively regulate STEAP2 levels by mediating m6A modification, which in turn inhibits PTC cell malignancy.24, 25 However, the mechanisms through which LINC00969 and METTL3 affect PTC require further investigation.

Objectives

This study aimed to elucidate the regulatory role of LINC00969 in PTC development and to demonstrate the tumor-suppressive role of METTL3 in PTC via m6A modification. The findings of our study broaden our understanding of the mechanisms underlying PTC development and provide valuable targets for PTC therapy.

Materials and methods

Clinical specimens

Samples from 32 patients diagnosed with PTC at Wuhan Third Hospital (Wuhan, China), including both PTC and corresponding normal tissues, were collected by surgical excision. The inclusion criteria were as follows: 1) all patients were initially diagnosed with PTC by 2 pathologists and 2) none of the patients underwent any treatment before surgery. The exclusion criteria were as follows: 1) patients who did not provide written consent and 2) patients with comorbidities such as thyroiditis and cervical lymphadenopathy. The clinical characteristics of patients with PTC is listed in Table 1. All clinical specimens were stored in a –80°C refrigerator. Prior to sample collection, all participants signed an informed consent form. The collection and use of human specimens were approved by the Ethics Committee of the Wuhan Third Hospital (approval No. KY2023-012).

Cell culture

The normal human thyroid cell line Nthy-ori-3-2 (BNCC340487) and PTC cell lines, including TPC-1 (BNCC337912) and IHH-4 (BNCC360242), were obtained from the BeNa Culture Collection (BNCC, Beijing, China). IHH-4 and TPC-1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; BNCC), whereas Nthy-ori-3-1 cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 (BNCC). Cell supernatants were supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin and maintained at 37°C with 5% CO2.

Cell transfection

LINC00969 or METTL3 sequences were cloned into a pcDNA3.1 vector for overexpression of LINC00969 or METTL3 (LINC00969-OE or METTL3-OE; RiboBio, Wuhan, China), with blank pcDNA3.1 used as the negative control (NC-OE). In addition, RiboBio synthesized the small interfering RNAs (siRNAs) targeting METTL3 (si-METTL3) and si-NC. Transfection of vector (2 μg/mL) or oligonucleotide (50 nM) was performed using Lipo6000 reagent (Beyotime Biotechnology, Shanghai, China).

qRT-PCR

A TransZol Up Plus RNA kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Reverse transcription and quantitative reverse transcription polymerase chain reaction (qRT-PCR) were performed using a cDNA Synthesis Kit (Fermentas, Waltham, USA) and SYBR Green Master Mix (Takara, Shiga, Tokyo, Japan), respectively. The qRT-PCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. Relative expression was determined using the 2ΔΔCt method with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the internal reference. Primer sequences are shown in Table 2.

Nucleus and cytoplasm localization

RNA from the cytoplasm and nuclei of IHH-4 and TPC-1 cells was isolated using a Nuclear and Cytoplasmic RNA Purification Kit (Norgen, Thorold, Canada) as described in a previous study. Quantification of LINC00969 levels in the cytoplasm and nucleus was performed using qRT-PCR.26

CCK-8 analysis

Cells (3 × 103 cells/well) were seeded into 96-well plates, and 100 μL of DMEM medium supplemented with 10% FBS was added. Cells were incubated for 0, 24, 48, and 72 h. Each well was then supplemented with Cell Counting Kit-8 (CCK-8) reagent (10 μL; Beyotime Biotechnology), and the plates were incubated at 37°C for 1 h. Optical density at 450 nm (OD450) was measured using a microplate reader (model 1681130; Bio-Rad, Hercules, USA).

Colony formation assay

Papillary thyroid carcinoma cells were collected, adjusted to a concentration of 2 × 103/mL, and transferred to the corresponding 6-well plates at 1 mL per well. Once colonies had grown to the appropriate size (after approx. 14 days of cell culture), the supernatant was removed, and the cells were washed. Paraformaldehyde (4%) was added for fixation at 25°C for 10 min. Subsequently, 700 μL of crystal violet staining solution was added for a 5-min staining period. The plates were allowed to dry, and images were captured using an optical microscope (model GX53; Olympus Corp., Tokyo, Japan). The number of clones in each well was determined.

Transwell assay

Dulbecco’s modified Eagle’s medium (500 μL) containing IHH-4 and TPC-1 cells (2 × 105) was added to the upper transwell insert, with or without Matrigel pre-addition for invasion or migration assays. The prepared inserts were then placed in the lower compartment with 750 μL of complete DMEM medium containing 10% FBS. Invading or migrating cells were stained with 0.1% crystal violet after 24 h of incubation. Cell counts were recorded under an optical microscope (model GX53; Olympus Corp.).

Methylated RNA immunoprecipitation assay

Methylated RNA immunoprecipitation (MeRIP) assays were conducted using the Magna MeRIP m6A kit purchased from Cloud-Seq Biotech (Shanghai, China). Total RNA (150 µg) extracted from cells treated with METTL3-OE or negative control of overexpression vector (NC-OE) was fragmented to produce fragments of 100 nucleotides or smaller. The fragmented RNA was then immunoprecipitated using magnetic beads precoated with 3 µg of anti-m6A antibody or anti-IgG. Finally, the immunoprecipitated RNA fragments were analyzed using qRT-PCR.27

RNA stabilization assay

IHH-4 and TPC-1 cells were treated with 2 µg/mL of the transcriptional inhibitor actinomycin D for 0, 3 and 6 h to block transcription. The cells were collected for RNA extraction, and qRT-PCR was performed to measure the LINC00969 levels.

Statistical analyses

Data expressed as mean ± standard deviation (±SD) were analyzed using GraphPad Prism v. 9 software (GraphPad, San Diego, USA). The normality of all data was assessed using the Shapiro–Wilk test (Supplementary Table 1), and the homogeneity of variance was analyzed using either the F test or Brown–Forsythe test (Supplementary Table 2). If the data followed a normal distribution and exhibited heterogeneous variance, Student’s t-test was used to compare differences between 2 groups, with significance set at p < 0.05. If the data did not follow a normal distribution or heterogeneous variance or if the sample size per group was less than 20, the Mann–Whitney U test was used for 2 groups, and the Kruskal–Wallis test followed by Dunnett’s post hoc test was used for multiple groups, with significance set at p < 0.05 (Supplementary Table 3). In addition, the data from Gene Expression Profiling Interactive Analysis (GEPIA; http://gepia.cancer-pku.cn/index.html) were analyzed using the R package limma.

Results

LINC00969 exhibits low expression in PTC

Gene Expression Profiling Interactive Analysis is an online tool that analyzes differentially expressed lncRNAs in THCA samples. Using GEPIA, we found that LINC00969 expression was significantly lower in 512 THCA samples compared to 337 normal samples (Figure 1A). To confirm this finding, we collected PTC tissues and adjacent normal tissues from 32 patients with PTC and assessed LINC00969 expression using qRT-PCR. The results showed a 70% downregulation of LINC00969 expression in PTC tissues (Figure 1B). Subsequently, we analyzed LINC00969 expression in 2 PTC cell lines (TPC-1 and IHH-4) and the normal human thyroid cell line Nthy-ori-3-2 using qRT-PCR, and LINC00969 was found to be downregulated in the PTC cell lines (Figure 1C). Furthermore, a nuclear–cytoplasmic isolation assay was conducted to determine the subcellular localization of LINC00969, showing higher levels of LINC00969 in the cytoplasm of PTC cells than in the nucleus, suggesting that LINC00969 was enriched in the cytoplasm (Figure 1D). Taken together, these findings suggest that LINC00969 expression was enriched in the cytoplasm and downregulated in PTC.

LINC00969 overexpression inhibits PTC cell malignancy

To confirm the function of LINC00969 in PTC, we constructed the LINC00969 overexpression vector (LINC00969-OE) and its negative control (NC-OE), which were then transfected into PTC cells. Subsequently, qRT-PCR was used to detect LINC00969 expression and verify the transfection efficiency. The results revealed a 6-fold increase in LINC00969 expression in the LINC00969-OE group compared to the NC-OE group, indicating the high transfection efficiency of LINC00969-OE (Figure 2A). Cell function assays were performed to analyze the effects of LINC00969 on the proliferation, migration and invasion of PTC cells. The CCK-8 assay demonstrated an approx. 40% reduction in cell viability in the LINC00969-OE group (Figure 2B). Colony formation analysis revealed that the number of colonies in the LINC00969-OE group decreased by nearly 70% compared to the NC-OE group (Figure 2C). Transwell assay results showed that LINC00969 upregulation led to approx. 62% and 70% reductions in PTC cell migration and invasion, respectively (Figure 2D,E). These results demonstrate that LINC00969 overexpression inhibits PTC cell malignancy.

METTL3 exhibits low expression in PTC and mediates the m6A modification of LINC00969

To identify the molecular targets of m6A in PTC, we determined the m6A modification site of LINC00969 using RMBase v2.0 (Figure 3A). Using the GEPIA database, we found a positive correlation between LINC00969 and METTL3 expression in THCA, and found that METTL3 expression was reduced in THCA (Figure 3B,C). In our clinical samples from 32 patients with PTC, qRT-PCR analysis also showed low METTL3 levels in PTC tissues and a positive correlation with LINC00969 expression (Figure 3D,E). The m6A modification of LINC00969 by METTL3 was examined using the MeRIP assay, and the results revealed that the m6A levels of LINC00969 were significantly increased following METTL3 upregulation, indicating that METTL3 could regulate LINC00969 through m6A modification in PTC (Figure 3F). Moreover, RNA stabilization assays revealed that METTL3 overexpression increased the resistance of LINC00969 to actinomycin D, indicating that METTL3 overexpression stabilized the RNA structure of LINC00969 (Figure 3G). Therefore, METTL3 downregulation in PTC could mediate the m6A modification of LINC00969, thereby stabilizing its RNA structure.

METTL3 silencing partially reverses the malignant blockage of PTC cells caused by LINC00969 overexpression

Subsequently, we investigated the effects of METTL3 combined with LINC00969 on the biological functions of PTC cells by transfecting the LINC00969-OE vector and si-METTL3 into PTC cells. The results of CCK-8 and colony formation assays showed that the decreased proliferation of PTC cells caused by LINC00969 overexpression was increased further when LINC00969-OE and si-METTL3 were co-transfected into PTC cells (Figure 4A,B). Moreover, transwell analysis revealed that both migration and invasion of PTC cells were impaired by the transfection of LINC00969-OE into PTC cells; however, this inhibitory effect on migration and invasion was enhanced by co-transfection of LINC00969-OE and si-METTL3 into PTC cells (Figure 4C,D). In conclusion, METTL3 knockdown reverses the inhibitory effects of LINC00969 overexpression on PTC malignancy.

Discussion

In this study, we elucidated the impact of LINC00969 on PTC cell function via the m6A modification of METTL3. We found that LINC00969 was downregulated in PTC, and its upregulation contributed to PTC cell malignancy, thereby alleviating PTC tumorigenesis. This study also confirmed that the m6A modification of LINC00969 could be induced by METTL3, thus enhancing the stability of LINC00969. METTL3 has been shown to suppress PTC progression by mediating the m6A modification of LINC00969.

Studies have found that dysregulated lncRNAs hold great potential as biomarkers of PTC. For instance, a study published in 2021 confirmed that LINC00671 attenuates PTC cell malignancy by interacting with LDHA and STAT3.11 In 2022, another lncRNA, ABHD11-AS1, was shown to enhance PTC cell malignancy by interacting with the EPS15L1/EGFR signaling pathway.12 These studies revealed the diverse functions of different lncRNAs in PTC. Here, we found that LINC00969 was downregulated in PTC. After reviewing the literature, only Dai et al.15 explored the function of LINC00969 in lung cancer, proving that LINC00969 promotes lung cancer progression by inhibiting cancer cell apoptosis. In contrast to the findings of Dai et al., we found that LINC00969 repressed PTC cell survival and metastasis, suggesting that LINC00969 inhibited PTC progression. This is the first study to demonstrate that LINC00969 plays different roles in different cancer types. LINC00969 is an antitumor factor in PTC and an oncogenic factor in lung cancer.

The m6A modifications that regulate lncRNAs have been recognized.17 Therefore, we investigated the m6A modification of LINC00969 in PTC. Our research showed that METTL3 in PTC mediates the m6A modification of LINC00969. The literature suggests that METTL3 regulates lncRNAs to affect cancer progression. For instance, in lung cancer, METTL3 induces m6A modifications that enhance the stability of ABHD11-AS1 transcripts and are strongly associated with unfavorable patient prognosis.28 Likewise, in prostate cancer, METTL3 regulates the m6A modification of the lncRNA SNHG7, enhancing its stability and subsequently accelerating cancer glycolysis.29 Furthermore, in gastric cancer, METTL3 induces the m6A modification of lncRNA THAP7-AS1 through an IGF2BP1-dependent pathway, which accelerates tumor development.30 Previous studies have confirmed the oncogenic role of METTL3 in cancer. However, our study is the first to provide evidence that METTL3 is an antitumor factor in PTC, showing that its downregulation in PTC and silencing promote PTC cell malignancy. Further analysis of the inhibitory effect of METTL3 on PTC revealed that METTL3 mediated the m6A modification of LINC00969 to enhance LINC00969 expression, thereby exerting an inhibitory effect on PTC cell malignancy. Our results align with the conventional understanding of METTL3 as a carcinogenic factor in cancer and that the different roles and regulatory mechanisms of METTL3 in different cancers need to be explored.

Limitations

This study elucidated the regulatory mechanism of LINC00969 interaction with METTL3 in PTC, but there were some limitations. First, the m6A modification consists of a “reader” protein, an “eraser” enzyme and a “writer” enzyme, which all play a role in regulating tumor cell malignancy in PCT.31 Although our study confirmed that the “writer” enzyme METTL3 mediates m6A modification of LINC00969, we have not investigated the “reader” protein or “eraser” enzyme. Therefore, further exploration is needed to understand the roles of LINC00969 and other m6A-modified proteins in PTC. Furthermore, our study collected clinical samples from only 32 patients with PTC, resulting in a small sample size that limited our ability to ascertain the clinical significance of LINC00969 and METTL3 in PTC. Future studies should aim to collect more extensive clinical samples to explore the relevance of LINC00969 and METTL3 to the histopathological phenotypes. Furthermore, the statistical analysis in our study was exploratory and did not incorporate multiple comparisons correction. Consequently, caution is warranted in interpreting the results due to the potential for uncontrolled type I error probability, which may also impact the validity of future meta-analyses. Nevertheless, this exploratory analysis provides a foundation for further research in the field.

Conclusions

This study revealed the downregulation of LINC00969 and METTL3 in PTC tissues and cells. Upregulation of LINC00969 inhibited PTC proliferation, migration and invasion; however, silencing METTL3 reversed the inhibitory effects of LINC00969 on PTC malignancy. Further mechanistic analysis confirmed that METTL3 mediated the m6A modification of LINC00969, stabilizing its RNA structure in PTC cells. This study presents a novel PTC regulatory mechanism based on the METTL3/LINC00969 axis, which may provide new diagnostic or therapeutic biomarkers for PTC.

Supplementary data

The Supplementary materials are available at https://doi.org/10.5281/zenodo.11080300. The package includes the following files:

Supplementary Table 1. The results of normality test.

Supplementary Table 2. The results of homogeneity of variance.

Supplementary Table 3. The results of statistical analysis.

Data availability

The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

Consent for publication

Not applicable.

Tables


Table 1. Clinical characteristics of papillary thyroid cancer patients (n = 32)

Variables

n (%)

Age [years]

 <45

18 (56.3)

 ≥45

14 (43.7)

Sex

male

10 (31.3)

female

22 (68.7)

Multifocality

yes

11 (34.4)

no

21 (65.6)

Location

left lobe

13 (40.6)

right lobe

16 (50.0)

bilateral

2 (6.3)

isthmus

1 (3.1)

Tumor stage

I–II

20 (62.5)

III–IV

12 (37.5)

Lymph node metastasis

yes

17 (53.1)

no

15 (46.9)

Table 2. Primer sequences of LINC00969 and METTL3 in qualitative reverse transcription polymerase chain reaction (qRT-PCR) assay

Name

Primer sequences

LINC00969

Forward (5’-3’): TGGTGGAAGTGAGACCGAAAT

Reverse (5’-3’): GTGATCCGTCCCAAGACAGC

METTL3

Forward (5’-3’): CAAGCTGCACTTCAGACGAA

Reverse (5’-3’): GCTTGGCGTGTGGTCTTT

GAPDH

Forward (5’-3’): GAAGGTGAAGGTCGGAGTC

Reverse (5’-3’): GAAGATGGTGATGGGATTTC

Figures


Fig. 1. LINC00969 exhibits low expression in papillary thyroid carcinoma (PTC). A. Gene Expression Profiling Interactive Analysis (GEPIA) showed the LINC00969 expression in thyroid cancer (THCA); *p < 0.001; B. LINC00969 expression in PTC and normal tissues was analyzed using qualitative reverse transcription polymerase chain reaction (qRT-PCR); **p < 0.001; C. LINC00969 expression in Nthy-ori-3-1 and PTC cell lines (IHH-4 and TPC-1) was analyzed using qRT-PCR; *p < 0.05, **p < 0.001 vs Nthy-ori-3-1; D. LINC00969 expression in the nucleus and cytoplasm of PTC cells was analyzed using qRT-PCR
Fig. 2. Overexpression of LINC00969 inhibits papillary thyroid carcinoma (PTC) cell malignancy. A. Qualitative reverse transcription polymerase chain reaction (qRT-PCR) revealed the LINC00969 expression in PTC cells transfected with LINC00969-OE or negative control of overexpression vector (NC-OE);
B,
C. Cell Counting Kit-8 (CCK-8) and colony formation assays detected PTC cell proliferation following transfection with LINC00969-OE or NC-OE; D,E. Transwell assay detected the migration and invasion of PTC cells transfected with LINC00969-OE or NC-OE; **p < 0.001 vs NC-OE
OD – optical density.
Fig. 3. METTL3 exhibits low expression in papillary thyroid carcinoma (PTC) and mediates the m6A modification of LINC00969. A. m6A modification site of LINC00969 according to RMBase v 2.0; B. Gene Expression Profiling Interactive Analysis (GEPIA) showed the correlation between LINC00969 and METTL3 in thyroid cancer (THCA); C. METTL3 expression in THCA using GEPIA; D. Qualitative reverse transcription polymerase chain reaction (qRT-PCR) revealed the METTL3 expression in PTC and normal tissues; **p < 0.001; E. Pearson’s analysis was used to assess the correlation between LINC00969 and METTL3 in PTC samples; F. MeRIP assay detected the m6A modification of LINC00969 in transfected PTC cells; **p < 0.001 vs NC-OE; G. LINC00969 stability in transfected NPC cells; **p < 0.001
Fig. 4. Silencing of METTL3 partially reverses the malignancy of papillary thyroid carcinoma (PTC) cells caused by LINC00969 overexpression. A,B. Cell proliferation in transfected PTC cells was revealed using Cell Counting Kit-8 (CCK-8) and colony formation assay; C,D. Cell migration and invasion in transfected PTC cells were detected using transwell assay; **p < 0.001 vs negative control of overexpression vector (NC-OE); #p < 0.05 vs LINC00969-OE + negative control of siRNA (si+NC); OD – optical density.

References (31)

  1. Aryanpour Z, Asban A, Boyd C, et al. A single institution experience with papillary thyroid cancer: Are outcomes better at comprehensive cancer centers? Am J Surg. 2021;222(4):802–805. doi:10.1016/j.amjsurg.2021.02.027
  2. Yang H, Liang Q, Zhang J, et al. Establishment of papillary thyroid cancer organoid lines from clinical specimens. Front Endocrinol (Lausanne). 2023;14:1140888. doi:10.3389/fendo.2023.1140888
  3. Bates MF, Lamas MR, Randle RW, et al. Back so soon? Is early recurrence of papillary thyroid cancer really just persistent disease? Surgery. 2018;163(1):118–123. doi:10.1016/j.surg.2017.05.028
  4. Zhang J, Fu C, Cui K, Ma X. Papillary thyroid carcinoma with tracheal invasion: A case report. Medicine (Baltimore). 2019;98(38):e17033. doi:10.1097/MD.0000000000017033
  5. Fallahi P, Ferrari SM, Galdiero MR, et al. Molecular targets of tyrosine kinase inhibitors in thyroid cancer. Semin Cancer Biol. 2022;79:180–196. doi:10.1016/j.semcancer.2020.11.013
  6. Bridges MC, Daulagala AC, Kourtidis A. LNCcation: lncRNA localization and function. J Cell Biol. 2021;220(2):e202009045. doi:10.1083/jcb.202009045
  7. Qian X, Zhao J, Yeung PY, Zhang QC, Kwok CK. Revealing lncRNA structures and interactions by sequencing-based approaches. Trends Biochem Sci. 2019;44(1):33–52. doi:10.1016/j.tibs.2018.09.012
  8. Li Y, Jiang T, Zhou W, et al. Pan-cancer characterization of immune-related lncRNAs identifies potential oncogenic biomarkers. Nat Commun. 2020;11(1):1000. doi:10.1038/s41467-020-14802-2
  9. Luo J, Langer LF, Liu J. A novel role of LncRNA in regulating tumor metabolism and angiogenesis under hypoxia. Cancer Commun (Lond). 2019;39(1):2. doi:10.1186/s40880-019-0348-x
  10. Zhou DL, Liu Q, Xu BH, et al. lncRNA GAS8-AS1 genetic alterations in papillary thyroid carcinoma and their clinical significance. Cancer Biomark. 2020;29(2):255–264. doi:10.3233/CBM-191071
  11. Huo N, Cong R, Sun ZJ, et al. STAT3/LINC00671 axis regulates papillary thyroid tumor growth and metastasis via LDHA-mediated glycolysis. Cell Death Dis. 2021;12(9):799. doi:10.1038/s41419-021-04081-0
  12. Lu H, Zhu C, Chen Y, et al. LncRNA ABHD11-AS1 promotes tumor progression in papillary thyroid carcinoma by regulating EPS15L1/EGFR signaling pathway. Clin Transl Oncol. 2022;24(6):1124–1133. doi:10.1007/s12094-021-02753-z
  13. Yu L, Hao Y, Xu C, Zhu G, Cai Y. LINC00969 promotes the degeneration of intervertebral disk by sponging miR-335-3p and regulating NLRP3 inflammasome activation. IUBMB Life. 2019;71(5):611–618. doi:10.1002/iub.1989
  14. Yu T, Xu B, Bao M, et al. Identification of potential biomarkers and pathways associated with carotid atherosclerotic plaques in type 2 diabetes mellitus: A transcriptomics study. Front Endocrinol (Lausanne). 2022;13:981100. doi:10.3389/fendo.2022.981100
  15. Dai J, Qu T, Yin D, et al. LncRNA LINC00969 promotes acquired gefitinib resistance by epigenetically suppressing of NLRP3 at transcriptional and posttranscriptional levels to inhibit pyroptosis in lung cancer. Cell Death Dis. 2023;14(5):312. doi:10.1038/s41419-023-05840-x
  16. Surguchov A. α-synuclein and mechanisms of epigenetic regulation. Brain Sci. 2023;13(1):150. doi:10.3390/brainsci13010150
  17. Ma S, Chen C, Ji X, et al. The interplay between m6A RNA methylation and noncoding RNA in cancer. J Hematol Oncol. 2019;12(1):121. doi:10.1186/s13045-019-0805-7
  18. Zhang H, Shi X, Huang T, et al. Dynamic landscape and evolution of m6A methylation in human. Nucl Acids Res. 2020;48(11):6251–6264. doi:10.1093/nar/gkaa347
  19. Liu J, Ren D, Du Z, Wang H, Zhang H, Jin Y. m6A demethylase FTO facilitates tumor progression in lung squamous cell carcinoma by regulating MZF1 expression. Biochem Biophys Res Commun. 2018;502(4):456–464. doi:10.1016/j.bbrc.2018.05.175
  20. Chen M, Wei L, Law C, et al. RNA N6-methyladenosine methyltransferase-like 3 promotes liver cancer progression through YTHDF2-dependent posttranscriptional silencing of SOCS2. Hepatology. 2018;67(6):2254–2270. doi:10.1002/hep.29683
  21. Liu T, Wei Q, Jin J, et al. The m6A reader YTHDF1 promotes ovarian cancer progression via augmenting EIF3C translation. Nucl Acids Res. 2020;48(7):3816–3831. doi:10.1093/nar/gkaa048
  22. Wu Y, Wang Z, Han L, et al. PRMT5 regulates RNA m6A demethylation for doxorubicin sensitivity in breast cancer. Mol Ther. 2022;30(7):2603–2617. doi:10.1016/j.ymthe.2022.03.003
  23. Zeng C, Huang W, Li Y, Weng H. Roles of METTL3 in cancer: Mechanisms and therapeutic targeting. J Hematol Oncol. 2020;13(1):117. doi:10.1186/s13045-020-00951-w
  24. Hou J, Shan H, Zhang Y, Fan Y, Wu B. m6A RNA methylation regulators have prognostic value in papillary thyroid carcinoma. Am J Otolaryngol. 2020;41(4):102547. doi:10.1016/j.amjoto.2020.102547
  25. Zhu Y, Peng X, Zhou Q, et al. METTL3-mediated m6A modification of STEAP2 mRNA inhibits papillary thyroid cancer progress by blocking the Hedgehog signaling pathway and epithelial-to-mesenchymal transition. Cell Death Dis. 2022;13(4):358. doi:10.1038/s41419-022-04817-6
  26. Chen Z, Li Y, He K, et al. CircGPRC5A enhances colorectal cancer progress by stabilizing PPP1CA and inducing YAP dephosphorylation. J Exp Clin Cancer Res. 2023;42(1):334. doi:10.1186/s13046-023-02915-7
  27. Fang D, Ou X, Sun K, et al. m6A modification-mediated lncRNA TP53TG1 inhibits gastric cancer progression by regulating CIP2A stability. Cancer Sci. 2022;113(12):4135–4150. doi:10.1111/cas.15581
  28. Xue L, Li J, Lin Y, et al. m6A transferase METTL3-induced lncRNA ABHD11-AS1 promotes the Warburg effect of non-small-cell lung cancer. J Cell Physiol. 2021;236(4):2649–2658. doi:10.1002/jcp.30023
  29. Liu J, Yuan JF, Wang YZ. METTL3-stabilized lncRNA SNHG7 accelerates glycolysis in prostate cancer via SRSF1/c-Myc axis. Exp Cell Res. 2022;416(1):113149. doi:10.1016/j.yexcr.2022.113149
  30. Liu HT, Zou YX, Zhu WJ, et al. lncRNA THAP7-AS1, transcriptionally activated by SP1 and post-transcriptionally stabilized by METTL3-mediated m6A modification, exerts oncogenic properties by improving CUL4B entry into the nucleus. Cell Death Differ. 2022;29(3):627–641. doi:10.1038/s41418-021-00879-9
  31. Zhu D, Zhou J, Zhao J, et al. ZC3H13 suppresses colorectal cancer proliferation and invasion via inactivating Ras–ERK signaling. J Cell Physiol. 2019;234(6):8899–8907. doi:10.1002/jcp.27551