Advances in Clinical and Experimental Medicine

Title abbreviation: Adv Clin Exp Med
Journal Impact Factor (JIF 2025) – 2.5
Journal Citation Indicator (JCI 2025) – 0.40
Scopus CiteScore (2025) – 4.2
Index Copernicus Value (ICV 2024) – 161.00
MNiSW – 70 pts
ISSN 1899–5276 (print), ISSN 2451-2680 (online)
Periodicity – monthly

Download original text (EN)

Advances in Clinical and Experimental Medicine

2022, vol. 31, nr 7, July, p. 781–788

doi: 10.17219/acem/146830

Publication type: original article

Language: English

License: Creative Commons Attribution 3.0 Unported (CC BY 3.0)

Download citation:

  • BIBTEX (JabRef, Mendeley)
  • RIS (Papers, Reference Manager, RefWorks, Zotero)

Cite as:


Fang Y, Liu J, Long Y, Wen J, Huang D, Xin L. Knockdown of circular RNA hsa_circ_0003307 inhibits synovial inflammation in ankylosing spondylitis by regulating the PI3K/AKT pathway. Adv Clin Exp Med. 2022;31(7):781–788. doi:10.17219/acem/146830

Knockdown of circular RNA hsa_circ_0003307 inhibits synovial inflammation in ankylosing spondylitis by regulating the PI3K/AKT pathway

Yanyan Fang1,A,C, Jian Liu1,A,E,F, Yan Long1,A,D, Jianting Wen1,B, Dan Huang1,B, Ling Xin1,E

1 The First Affiliated Hospital of Anhui University of Chinese Medicine, Hefei, China

Abstract

Background. Ankylosing spondylitis (AS) has a high disability rate, and an early diagnosis is difficult.

Objectives. To explore the possible functions and underlying mechanism of circular RNAs Homo sapiens (hsa)_circ_0003307 in ankylosing spondylitis.

Materials and methods. The hsa_circ_0003307 expression levels were investigated in the peripheral blood mononuclear cells (PBMCs) of 30 AS patients and 30 healthy controls (HC) using quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis. Primary fibroblast-like synoviocytes (FLS) were separated from synovial tissues, established as cell lines and cultured for subsequent cell experiments involving transfection with different vectors. The qRT-PCR analysis was used for evaluating the levels of hsa_circ_0003307 in AS-FLS. Phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT) pathway-related protein levels were measured using western blotting and immunofluorescence. Enzyme-linked immunosorbent assay (ELISA) was used to detect the levels of inflammatory cytokines. Spearman’s correlation analysis was used to assess the correlation between hsa_circ_0003307 and clinical characteristics.

Results. The expression level of hsa_circ_0003307 was significantly high in AS patients and was positively associated with erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), Bath Ankylosing Spondylitis Disease Activity Index (BASDAI), and Bath Ankylosing Spondylitis Functional Index (BASFI). We found that hsa_circ_0003307 overexpression could promote the activation of the PI3K/AKT pathway and expression of inflammatory cytokines – tumor necrosis factor alpha (TNF-α) and TNF-α-induced protein 2 (TNFAIP2). However, hsa_circ_0003307 knockdown reduced the expression of TNF-α and TNFAIP2.

Conclusions. The expression level of hsa_circ_0003307 was associated with inflammatory response, and it was revealed that hsa_circ_0003307 knockdown could reduce the inflammatory response of AS by regulating the PI3K/AKT pathway.

Key words: ankylosing spondylitis, PI3K/AKT, hsa_circ_0003307

Background

Ankylosing spondylitis (AS) is a chronic refractory inflammatory arthritis, characterized by chronic nonspecific inflammation.1 The sacroiliac joints and spine are the body parts most commonly affected by AS.2 If not treated in time, it affects the movement of the spine joints, and even spinal joint stiffness and deformity will appear.3 This seriously worsen the quality of life of patients. This disease is mainly painful in the early stage, when the symptoms of unfavorable spinal joint movement are not obvious, and it is not easy to be diagnosed. Often, when AS is clearly diagnosed, irreversible joint damage has already occurred, and other system diseases may also be observed. The treatment of AS brings a huge economic burden to the families of the patients and the whole community. Therefore, an early diagnosis is very important for AS patients and their families. There is an urgent need to identify new biomarkers that could be used as indicators for the diagnosis or prognosis of AS. The discovery of such biomarkers may have inestimable value for the early diagnosis and treatment of AS.

Circular RNA (circRNA) is a unique RNA composed of exons, introns, or the products of reverse splicing of both.4 Because circRNA has no 5 or 3 ends, it can withstand RNase digestion and is more stable than most linear RNAs.5 In addition to its characteristics of a relatively high stability, circRNA often exhibits tissue/developmental stage-specific expression,6, 7 and is therefore more suitable as a biomarker than linear RNA.8 Previous studies have confirmed that circRNA may control gene transcription by isolating target microRNAs (miRNAs) and regulating RNA-binding proteins, thereby acting as an “miRNA sponge”.9 There is increasing evidence that certain circRNAs may be related to the risk of neurological, atherosclerotic vascular, prion, cancer, and autoimmune diseases.10, 11, 12, 13 This supports the hypothesis that circRNAs may become new diagnostic and prognostic biomarkers, and new disease treatment targets.14, 15 However, the current understanding of circRNA in AS patients is limited.

Phosphatidylinositol-3 kinase (PI3K)/protein kinase B (AKT) is an important inflammatory pathway that participates in a variety of physiological and pathological processes in the body. After activation, it participates in cell signal transduction, growth, angiogenesis, and carcinogenic transformation.16 The PI3K is affected by cytokines to change the protein structure of AKT and activate it, thereby regulating the release of pro-inflammatory mediators.17 Studies have shown that the PI3K/AKT//mammalian target of rapamycin (mTOR) signaling pathway plays a role in cartilage degeneration, subchondral bone dysfunction and synovial inflammation.18, 19 Therefore, this study verified the diagnostic effect of circ_0003307 by observing the influence of circ_0003307 on the PI3K/AKT pathway.

Objectives

The objective of this study was to explore the possible role of a certain circRNA, Homo sapiens (hsa)_circ_0003307, in AS. To achieve this, we detected the expression level of circRNA_0003307 in peripheral blood mononuclear cells (PBMCs) of AS patients. Thereafter, we verified the possible role of the edited circRNA_0003307 in the inflammatory response of AS-fibroblast-like synoviocytes (AS-FLS).

Materials and methods

Patients and healthy controls

Thirty AS patients were recruited from the Department of Rheumatology, Anhui Provincial Hospital of Traditional Chinese Medicine, Hefei, China. These patients were diagnosed by interviewers in accordance with the New York criteria revised by the American College of Rheumatology.20, 21 At the same time, we also recruited 30 healthy subjects whose age and gender matched those of AS patients as healthy controls (HC). Both the patient and the HC group ruled out the history of other diseases. The research protocol was in line with the Declaration of Helsinki. This study was approved by the Medical Ethics Committee of Anhui Provincial Hospital of Traditional Chinese Medicine (approval No. 2020AH-08).

Isolation of PBMCs and extraction
of total RNA

Peripheral blood (5 mL) of the subjects was collected using an ethylenediaminetetraacetic acid (EDTA) anticoagulation tube. A discontinuous density gradient (Histopaque-1077; Sigma-Aldrich, St. Louis, USA) was used to separate PBMCs. Total RNA was extracted using TRI-Reagent (Invitrogen, Carlsbad, USA) and stored at −80°C. The RNA concentration was determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, USA), and RNA integrity was assessed with agarose gel electrophoresis.

Cell culture

Synovial tissue specimens were obtained from AS patients undergoing hip replacement surgery. The specimens were cut into small pieces and mixed with 4 mg/mL collagenase (type I) (Sigma-Aldrich) for 1 h. Then, the cells were digested with 0.25% trypsin. Thereafter, AS-FLS cells were collected and added to Dulbecco’s modified Eagle’s culture medium (DMEM; HyClone Laboratories, Inc., Logan, USA) containing 10% fetal bovine serum (FBS; Sigma-Aldrich) and 1% streptomycin and penicillin (Beyotime, Shanghai, China). Cells were maintained at 37°C and 5% CO2. The isolated AS-FLS were cultivated from the 3rd to the 6th generation for further study.

Cell transfection

The pcDNA3.1-hsa_circ_0003307 was generated by amplifying the coding sequence of circRNA_0003307 and inserting it into pcDNA3.1(+). Small interfering RNAs (siRNAs) were targeted to circRNA_0003307 (siRNA1: 5-AGGCUGGAAACCAUCGACGTT-3, siRNA2: 5-C’UGGAAACCAUC GACGAGUTT-3, siRNA3: 5-GAAACCAUCGACGAGUACATT-3). Nonsense control siRNA (si-NC) was purchased from GenePharma (Shanghai, China). Lipofectamine 2000 (Invitrogen) was used for the transient transfection of vectors at room temperature. After that, the cells were incubated for 24 h before their use in subsequent experiments.

qRT-PCR

Extracted total RNA was reverse transcribed to cDNA using the Prime Script RT Reagent Kit (TaKaRa, Dalian, China) with gDNA Eraser. After that, according to the manufacturer’s instructions, TB Green Premix Ex Taq (Tli RNase H Plus; TaKaRa, Kusatsu, Japan) was used for the quantitative reverse transcription polymerase chain reaction (qRT-PCR). The internal control β-actin primer sequence is shown in Table 1. Primers were synthesized by Sangon Biotech (Shanghai, China). The 2−ΔΔct method was used to calculate the relative expression level of circRNA_0003307.

Western blotting

Commercial kits (Pierce, Rockford, USA) were used to extract cytoplasmic and nuclear proteins from AS-FLS. A sample was prepared for electrophoresis on a Novex 10% sodium lauryl sulphate/polyacrylamide gel (Thermo Fisher Scientific). Then, the membrane was blocked with 5% skimmed milk powder in Tris-buffered saline and combined with rabbit anti-human anti-phosphorylated (p)-PI3K (dilution 1:1000; cat. No. ab182651; Abcam, Cambridge, USA) or rabbit anti-human anti-p-AKT (dilution 1:2000; cat. No. 4060s; Abcam) and incubated overnight. After washing 3 times, the membrane was incubated with anti-rabbit immunoglobulin G secondary antibody (dilution 1:20,000; cat. No. ab6721; Abcam) at room temperature for 1.5 h. Proteins were detected using enhanced chemiluminescence (ECL; Merck Millipore, Burlington, USA) and quantified using ImageQuant LAS 4000 (GE Healthcare Life Science, Pittsburgh, USA).

Immunofluorescence assay

After 48 h of transfection, AS-FLS were permeabilized with 0.5% Triton X100 in phosphate-buffered saline (PBS), and blocked with 2% bovine serum albumin for 15 min at room temperature. The cells were then incubated with primary antibodies and diluted in blocking buffer at 4°C overnight. This was followed by the incubation with the fluorophore-conjugated secondary antibody (1:1000; Invitrogen) in blocking buffer for 1 h at room temperature. The nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI; Invitrogen). Images were obtained using a Zeiss LSM710 confocal microscope (Carl Zeiss AG, Jena, Germany).

ELISA

Enzyme-linked immunosorbent assay (ELISA) was performed according to the instructions of the tumor necrosis factor alpha (TNF-α; product No. JYM0110Hu) and TNF-α-induced protein 2 (TNFAIP2; product No. JYM2468Hu) kits (Wuhan Genemei Technology, Wuhan, China) to determine the expression levels of TNF-α and TNFAIP2 in the AS-FLS supernatant. Absorbance was determined at the optical density (OD) of 450 nm. The contents were calculated according to standard curves.

Statistical analyses

Statistical analyses were performed and graphs were created using GraphPad Prism v. 8 software (GraphPad Software, San Diego, USA). Age was analyzed using Student’s t-test (Supplementary Table 1A,B). The expression of circRNA_0003307 in PBMCs was analyzed using Welch’s t-test (Supplementary Table 2A,B). Categorical variables were compared using the χ2 test. Correlations were assessed using the Spearman’s analysis because clinical characteristics were not normally distributed (Supplementary Table 3). The circRNA_0003307 expression in AS-FLS was analyzed using a one-way analysis of variance (ANOVA) followed by the Games–Howell test (Supplementary Table 4A–C). The p-PI3K protein expression in AS-FLS was analyzed using a one-way ANOVA followed by the Games–Howell test (Supplementary Table 5A–C). The p-AKT protein expression in AS-FLS was analyzed using a one-way ANOVA followed by the Games–Howell test (Supplementary Table 6A–C). The TNF-α levels in AS-FLS were analyzed using a one-way ANOVA followed by the Games–Howell test (Supplementary Table 7A–C). The TNFAIP2 levels in AS-FLS were analyzed using a one-way ANOVA followed by Games–Howell test (Supplementary Table 8A–C). A receiver operating characteristic (ROC) curve analysis was performed to judge whether circRNA_0003307 can be used as a diagnostic indicator for AS. A value of p < 0.05 indicates that the difference was statistically significant. All Supplementary Tables with the description of statistical methods and the results of statistical tests are available at https://doi.org/10.5281/zenodo.6244943.

Results

General situation of the research subjects

Thirty AS patients and 30 HC were examined in this study. The general situation of the 2 groups of subjects is exhibited in Table 2. There was no significant difference between AS patients and HC in terms of age (t = 0.1370, p = 0.8915, degrees of freedom (df) = 58) or gender (χ2 = 0.000, p > 0.999, df = 1) (Table 2).

Expression of circ_0003307 in PBMCs

To detect the level of circRNA_0003307 in PBMCs of AS patients, qRT-PCR was performed. The results showed that the level of circRNA_0003307 in PBMCs of AS patients was significantly higher than that of the HC group (t = 15.32, p < 0.0001, df = 47.30; Figure 1A). To evaluate the diagnostic value of circRNA_0003307, a ROC curve analysis was performed. The area under the curve (AUC) of circRNA_0003307 was 0.8533 (95% confidence interval (95% CI): [0.7564; 0.9503]). The results indicate that circRNA_0003307 has potential value in diagnosing AS (Figure 1B).

Correlation analysis of circRNA_0003307 and clinical characteristics of AS patients

The results of the Spearman’s analysis (the distribution of the correlated variables was non-normal – cf. Supplementary Table 3) showed that the expression level of circRNA_0003307 in PBMCs of AS patients was positively correlated with clinical characteristics, including erythrocyte sedimentation rate (ESR; r = 0.7188, p < 0.0001; Figure 2A), C-reactive protein (CRP) level (r = 0.6309, p = 0.0002; Figure 2B), Bath Ankylosing Spondylitis Functional Index (BASFI) (r = 0.4126, p = 0.0235; Figure 2C), and Bath Ankylosing Spondylitis Disease Activity Index (BASDAI) (r = 0.6295, p = 0.0002; Figure 2D). The overall evidence indicate that the abnormal expression of circRNA_0003307 may be related to the pathogenesis of AS.

CircRNA_0003307 expression in AS-FLS

The expression of circRNA_0003307 in AS-FLS was detected using the qRT-PCR. In addition, qRT-PCR was used to detect the expression following overexpression and knockdown. These results showed that, through transfection of the circRNA_0003307 overexpression vector, circRNA_0003307 was significantly increased (t = 13.68, p < 0.0001, df = 7.171), while circRNA_0003307 knockdown with siRNA resulted in a significant decrease (t = 18.15, p < 0.0001, df = 8.776, Figure 3).

Effect of abnormal expression of circRNA_0003307 on the PI3K/AKT pathway

To determine the effect of abnormal expression of circRNA_0003307 on AS-related pathways, we tested the expression of PI3K/AKT pathway-related proteins through western blotting and immunofluorescence (IF) assay. Compared with the AS-FLS group, AS-FLS transfected with pcDNA3.1-hsa_circ_0003307 showed a significant increase in the protein expression of p-PI3K (t = 21.81, p = 0.0015, df = 2.806) and p-AKT (t = 4.744, p = 0.0451, df = 3.768, Figure 4A–C), whereas these protein levels were significantly decreased in AS-FLS transfected with si-hsa_circ_0003307 compared with those in the AS-FLS group (tp-PI3K = 11.13, pp-PI3K = 0.0050, dfp-PI3K = 3.167; tp-AKT = 4.851, pp-AKT = 0.0396, dfp-AKT = 3.884, Figure 4A–C). The IF assay used to analyze protein expression in these AS-FLS yielded similar results (Figure 4D,E). These results indicate that the PI3K/AKT signaling pathway can be activated by circRNA_0003307, which is highly expressed in AS.

Effects of aberrant circRNA_0003307 expression on inflammatory cytokines

To study the effect of circRNA_0003307 on the inflammatory response of AS following the activation of the PI3K/AKT pathway, ELISA was used to detect the expression of the inflammatory factors – TNF-α and TNFAIP2. The results showed that TNF-α and TNFAIP2 levels in AS-FLS significantly decreased when AS-FLS was transfected with si-hsa_circ_0003307 (tTNF-α = 4.686, pTNF-α = 0.0110, dfTNF-α = 7.662; tTNFAIP2 = 5.066, pTNFAIP2 = 0.0157, dfTNFAIP2 = 5.536, Figure 5A,B) compared with si-NC. In addition, AS-FLS induced with pcDNA3.1-hsa_circ_0003307 showed higher levels of TNF-α and TNFAIP2 than pcDNA3.1-NC (tTNF-α = 11.51, pTNF-α < 0.0001, dfTNF-α = 6.077; tTNFAIP2 = 28.84, pTNFAIP2 < 0.0001, dfTNFAIP2 = 8.741, Figure 5A,B).

Discussion

The discovery of circRNAs has provided novel insights into AS treatment, and it is of vital significance for identifying new diagnostic and therapeutic targets for AS. A growing number of studies in recent years have greatly broadened our horizons regarding circRNA functions and increased its value in disease diagnosis. Many circRNAs are dysregulated in rheumatic disorders, and the clinical significance of dysregulated circRNAs in such disorders has been investigated previously. For example, Ouyang et al. confirmed that circRNA_002453 may serve as a diagnostic marker for AS.22 They have proven that the upregulated circRNA in the plasma of AS patients can aggravate the degree of renal involvement. Wang et al. indicated that circIBTK may also act as a therapeutic target for systemic lupus erythematosus (SLE), and its therapeutic mechanism might regulate DNA demethylation and downstream signaling pathways by targeting miR-29b in SLE.23

These findings confirm the existence of useful information about mRNA profiles in the PBMCs of AS patients.15 In addition, researchers have used bioinformatics methods to predict the genes that were differentially expressed in AS, and research the role of these differential genes in the pathogenesis of AS. This information allows us to better understand the pathogenesis of AS, and it is possible to discover new diagnosis and treatment methods from it. For this study, we selected circRNA_0003307. To determine the pathway of circRNA_0003307 in AS-FLS involved in the pathogenesis, we chose PI3K/AKT as the research pathway. The reason is that PI3K/AKT plays a key role in the pathogenesis of AS and provide a breakthrough in AS treatment. Terlemez et al., Yan et al. and Liu et al. proved that miRNAs affects the phenotype of FLS in rheumatism by regulating the expression of PI3K/AKT, thereby affecting the pathogenesis of rheumatism.24, 25, 26 Therefore, we speculate that there may be a regulatory relationship between circRNA_0003307 and the PI3K/AKT pathway.

The results of this study showed that high expression level of circRNA_0003307 was positively correlated with the severity of AS. Li et al. reported that the circ_0056558 level was highly expressed in AS tissue, and was achieved through the PI3K/AKT pathway.27 In our study, circRNA_0003307 was overexpressed in PBMCs of AS patients compared with healthy participants. There was a positive correlation between circRNA_0003307 levels and ESR, CRP level, BASDAI, and BASFI. Luo et al. demonstrated that low expression of hsa_circ_0079787 in peripheral blood of AS patients was negatively correlated with BASDAI, which was in concert with our data.28 Collectively, the expression level of circRNA_0003307 was associated with disease activity.29

CircRNA_0003307 activated the PI3K/AKT signaling pathway and affected the expression of the downstream inflammatory factors – TNF-α and TNFAIP2. The results of the study confirmed our hypothesis stating that the protein expression of p-PI3K and p-AKT was altered by both overexpression and knockdown of circRNA_0003307. Li et al. demonstrated that hsa_circ_0056558 inhibited the PI3K/AKT pathway by targeting miR-1290 in AS, and reduced the protein expression of p-AKT.27 A further analysis showed that the overexpression of circRNA_0003307 markedly increased the protein expression level of p-PI3K and p-AKT. However, for circRNA_0003307 knockdown, the protein expression level was significantly reduced. Thus, PI3K/AKT is involved in immune-mediated inflammatory responses. Simultaneously, the findings showed that the overexpression of circRNA_0003307 increased the expression of the downstream inflammatory factors – TNF-α and TNFAIP2, while the knockdown of circRNA_0003307 showed the opposite results, reducing the expression of TNF-α and TNFAIP2.

Kou et al. demonstrated that circRNAs may be involved in the PI3K/AKT signaling pathways associated with inflammation-induced apoptosis in chondrocytes.30 The activation of p-PI3K could induce downstream p-AKT. Inflammatory cytokines, such as TNF-α and interleukin 17 (IL-17), are involved in the pathogenesis of AS.31 Taken together, the expression level of circRNA_0003307 is closely related to the AS inflammatory response.

Limitations

This study has certain limitations. In our subjects, we found that the overexpression of circRNA_0003307 increased the levels of p-PI3K, p-AKT, TNF-α, and TNFAIP2 in AS-FLS. The knockdown of circRNA_0003307 showed the opposite results, reducing the expression of p-PI3K, p-AKT, TNF-α, and TNFAIP2. However, the detailed mechanism of circRNA_0003307-targeted activation of the PI3K/AKT pathway remains unclear. We also lacked patients with other autoimmune diseases as a control group to clarify that circRNA_0003307 is specific to AS.

Conclusions

The present study revealed that the knockdown of circRNA_0003307 inhibits synovial inflammation in AS by regulating the PI3K/AKT pathway. In addition, the expression level of circRNA_0003307 was associated with disease activity. The circRNA_0003307 was highly expressed in AS-PBMCs and AS-FLS, and circRNA_0003307 knockdown reduced the inflammatory response of AS-FLS by regulating the PI3K/AKT pathway. These findings suggest that targeting circRNA_0003307 offers a promising therapeutic strategy for AS patients and may serve as a potential target for AS treatment. Based on these findings, our research team will explore the possible competing endogenous RNA molecular mechanism of circRNA_0003307 in future studies of AS.

Tables


Table 1. Primer sequences for hsa_circ_0003307

Name

Size (bp)

Sequence (5’3’)

β-actin

96

F: CCCTGGAGAAGAGCTACGAG

R: GGAAGGAAGGCTGGAAGAGT

circRNA0003307

77

F: CTGTCATCAACCTGGGAAGG

R: ACGGGTTGGTGGTAGCAT

Table 2. General situation of the research subjects

Variables

AS (n = 30)

HC (n = 30)

χ2/t

p-value

df

Sex (M/F)

24/6

24/6

χ2 = 0.0000

>0.9999

1

Age [years], mean ±SD

36.4300 ±10.3300

36.1000 ±8.4170

t = 0.1370

0.8915

58

ESR [mm/h], median (Q1, Q3)

30.00 (17.00, 45.25)

N/A

N/A

N/A

N/A

CRP [mg/L], median (Q1, Q3)

37.13 (23.03, 71.11)

N/A

N/A

N/A

N/A

BASDAI score, median (Q1, Q3)

5.60 (5.40, 6.60)

N/A

N/A

N/A

N/A

BASFI score, median (Q1, Q3)

6.45 (6.20, 6.80)

N/A

N/A

N/A

N/A

ESR – erythrocyte sedimentation rate; CRP – C-reactive protein; BASDAI – Bath Ankylosing Spondylitis Disease Activity Index; BASFI – Bath Ankylosing Spondylitis Functional Index; N/A – not applicable; SD – standard deviation; Q1 – 1st quartile; Q3 – 3rd quartile; AS – ankylosing spondylitis; HC – healthy controls; df – degrees of freedom.

Figures


Fig. 1. Validation of abnormal expression of circRNA_0003307 and receiver operating characteristic (ROC) curve analysis
AUC – area under the curve; AS – ankylosing spondylitis; HC – healthy controls.
Fig. 2. Spearman’s correlation analysis of circRNA_0003307 and clinical characteristics of ankylosing spondylitis (AS) patients
ESR – erythrocyte sedimentation rate; CRP – C-reactive protein; BASFI – Bath Ankylosing Spondylitis Functional Index; BASDAI – Bath Ankylosing Spondylitis Disease Activity Index.
Fig. 3. Differential expression of circRNA_0003307 in ankylosing spondylitis fibroblast-like synovial cells
si-NC – nonsense control siRNA.
Fig. 4. Boxplots of the effect of circRNA_0003307 on the phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT) pathway
si-NC – nonsense control siRNA.
Fig. 5. Boxplots of the effect of circRNA_0003307 on inflammatory cytokines
si-NC – nonsense control siRNA; TNF-α – tumor necrosis factor alpha; TNFAIP2 – TNF- α-induced protein 2.

References (31)

  1. Garcia-Montoya L, Gul H, Emery P. Recent advances in ankylosing spondylitis: Understanding the disease and management. F1000Res. 2018;7:F1000–1512. doi:10.12688/f1000research.14956.1
  2. Bergman M, Lundholm A. Managing morbidity and treatment-related toxicity in patients with ankylosing spondylitis. Rheumatology (Oxford). 2018;57(3):419–428. doi:10.1093/rheumatology/kex292
  3. Maksymowych WP. Disease modification in ankylosing spondylitis. Nat Rev Rheumatol. 2010;6(2):75–81. doi:10.1038/nrrheum.2009.258
  4. Chen LL, Yang L. Regulation of circRNA biogenesis. RNA Biol. 2015;12(4):381–388. doi:10.1080/15476286.2015.1020271
  5. Hentze MW, Preiss T. Circular RNAs: Splicing’s enigma variations. EMBO J. 2013;32(7):923–925. doi:10.1038/emboj.2013.53
  6. Salzman J, Chen RE, Olsen MN, Wang PL, Brown PO. Cell-type specific features of circular RNA expression. PLoS Genet. 2013;9(9):e1003777. doi:10.1371/journal.pgen.1003777. Erratum in: PLoS Genet. 2013;9(12). doi:10.1371/annotation/f782282b-eefa-4c8d-985c-b1484e845855
  7. Szabo L, Morey R, Palpant NJ, et al. Statistically based splicing detection reveals neural enrichment and tissue-specific induction of circular RNA during human fetal development. Genome Biol. 2015;16(1):126. doi:10.1186/s13059-015-0690-5. Erratum in: Genome Biol. 2016;17(1):263. doi:10.1186/s13059-016-1123-9
  8. Suzuki H, Tsukahara T. A view of pre-mRNA splicing from RNase R resistant RNAs. Int J Mol Sci. 2014;15(6):9331–9342. doi:10.3390/ijms15069331
  9. Hansen TB, Jensen TI, Clausen BH, et al. Natural RNA circles function as efficient microRNA sponges. Nature. 2013;495(7441):384–388. doi:10.1038/nature11993
  10. Kumar L, Shamsuzzama, Haque R, Baghel T, Nazir A. Circular RNAs: The emerging class of non-coding RNAs and their potential role in human neurodegenerative diseases. Mol Neurobiol. 2017;54(9):7224–7234. doi:10.1007/s12035-016-0213-8
  11. Wang L, Shen C, Wang Y, et al. Identification of circular RNA Hsa_circ_0001879 and Hsa_circ_0004104 as novel biomarkers for coronary artery disease. Atherosclerosis. 2019;286:88–96. doi:10.1016/j.atherosclerosis.2019.05.006
  12. Qu S, Liu Z, Yang X, et al. The emerging functions and roles of circular RNAs in cancer. Cancer Lett. 2018;414:301–309. doi:10.1016/j.canlet.2017.11.022
  13. Ouyang Q, Wu J, Jiang Z, et al. Microarray expression profile of circular RNAs in peripheral blood mononuclear cells from rheumatoid arthritis patients. Cell Physiol Biochem. 2017;42(2):651–659. doi:10.1159/000477883
  14. Wang F, Nazarali AJ, Ji S. Circular RNAs as potential biomarkers for cancer diagnosis and therapy. Am J Cancer Res. 2016;6(6):1167–1176. PMID:27429839. PMCID:PMC4937728.
  15. Huang D, Liu J, Cao Y, et al. RNA sequencing for gene expression profiles in peripheral blood mononuclear cells with ankylosing spondylitis RNA. Biomed Res Int. 2020;2020:5304578. doi:10.1155/2020/5304578
  16. Utermark T, Rao T, Cheng H, et al. The p110α and p110β isoforms of PI3K play divergent roles in mammary gland development and tumorigenesis. Genes Dev. 2012;26(14):1573–1586. doi:10.1101/gad.191973.112
  17. Patel AB, Tsilioni I, Weng Z, Theoharides TC. TNF stimulates IL-6, CXCL8 and VEGF secretion from human keratinocytes via activation of mTOR, inhibited by tetramethoxyluteolin. Exp Dermatol. 2018;27(2):135–143. doi:10.1111/exd.13461
  18. Sun K, Luo J, Guo J, Yao X, Jing X, Guo F. The PI3K/AKT/mTOR signaling pathway in osteoarthritis: A narrative review. Osteoarthritis Cartilage. 2020;28(4):400–409. doi:10.1016/j.joca.2020.02.027
  19. Zhang Y, Cai W, Han G, et al. Panax notoginseng saponins prevent senescence and inhibit apoptosis by regulating the PI3K AKT mTOR pathway in osteoarthritic chondrocytes. Int J Mol Med. 2020;45(4):1225–1236. doi:10.3892/ijmm.2020.4491. Erratum in: Int J Mol Med. 2021;47(1):408–409. doi:10.3892/ijmm.2020.4786. Erratum in: Int J Mol Med. 2022;49(3):30. doi:10.3892/ijmm.2022.5085
  20. Van der Linden S, Valkenburg HA, Cats A. Evaluation of diagnostic criteria for ankylosing spondylitis: A proposal for modification of the New York criteria. Arthritis Rheum. 1984;27(4):361–368. doi:10.1002/art.1780270401
  21. Goie The HS, Steven MM, van der Linden SM, Cats A. Evaluation of diagnostic criteria for ankylosing spondylitis: A comparison of the Rome, New York and modified New York criteria in patients with a positive clinical history screening test for ankylosing spondylitis. Br J Rheumatol. 1985;24(3):242–249. doi:10.1093/rheumatology/24.3.242
  22. Ouyang Q, Huang Q, Jiang Z, Zhao J, Shi GP, Yang M. Using plasma circRNA_002453 as a novel biomarker in the diagnosis of lupus nephritis. Mol Immunol. 2018;101:531–538. doi:10.1016/j.molimm.2018.07.029
  23. Wang X, Zhang C, Wu Z, Chen Y, Shi W. CircIBTK inhibits DNA demethylation and activation of AKT signaling pathway via miR-29b in peripheral blood mononuclear cells in systemic lupus erythematosus. Arthritis Res Ther. 2018;20(1):118. doi:10.1186/s13075-018-1618-8
  24. Terlemez R, Akgün K, Palamar D, Boz S, Sarı H. The clinical importance of the thyroid nodules during anti-tumor necrosis factor therapy in patients with axial spondyloarthritis. Clin Rheumatol. 2017;36(5):1071–1076. doi:10.1007/s10067-017-3607-8
  25. Yan X, Liu Y, Kong X, et al. MicroRNA-21-5p are involved in apoptosis and invasion of fibroblast-like synoviocytes through PTEN/PI3K/AKT signal. Cytotechnology. 2019;71(1):317–328. doi:10.1007/s10616-018-0288-3
  26. Liu S, Cao C, Zhang Y, et al. PI3K/Akt inhibitor partly decreases TNF-α-induced activation of fibroblast-like synoviocytes in osteoarthritis. J Orthop Surg Res. 2019;14(1):425. doi:10.1186/s13018-019-1394-4
  27. Li X, Zhou W, Li Z, Guan F. Hsa_circ_0056558 regulates cyclin-dependent kinase 6 by sponging microRNA-1290 to suppress the proliferation and differentiation in ankylosing spondylitis. Autoimmunity. 2021;54(2):114–128. doi:10.1080/08916934.2021.1894417
  28. Luo Q, Fu B, Zhang L, Guo Y, Huang Z, Li J. Expression and clinical significance of circular RNA hsa_circ_0079787 in the peripheral blood of patients with axial spondyloarthritis. Mol Med Rep. 2020;22(5):4197–4206. doi:10.3892/mmr.2020.11520
  29. Kook H, Jin S, Park P, Lee S, Shin H, Kim T. Serum miR-214 as a novel biomarker for ankylosing spondylitis. Int J Rheum Dis. 2019;22(7):1196–1201. doi:10.1111/1756-185X.13475
  30. Kou J, Liu G, Liu X, et al. Profiling and bioinformatics analysis of differentially expressed circRNAs in spinal ligament tissues of patients with ankylosing spondylitis. Biomed Res Int. 2020;2020:7165893. doi:10.1155/2020/7165893
  31. Braga M, Lara-Armi FF, Neves JSF, et al. Influence of IL10 (rs1800896) polymorphism and TNF-α, IL-10, IL-17A, and IL-17F serum levels in ankylosing spondylitis. Front Immunol. 2021;12:653611. doi:10.3389/fimmu.2021.653611