Advances in Clinical and Experimental Medicine

Title abbreviation: Adv Clin Exp Med
5-Year IF – 2.0, IF – 1.9, JCI (2024) – 0.43
Scopus CiteScore – 4.3
Q1 in SJR 2025, SJR score – 0.599, H-index: 54 (SJR)
ICV – 161.00; MNiSW – 70 pts
Initial editorial assessment and first decision within 24 h

ISSN 1899–5276 (print), ISSN 2451-2680 (online)
Periodicity – monthly

Download original text (EN)

Advances in Clinical and Experimental Medicine

2021, vol. 30, nr 9, September, p. 933–939

doi: 10.17219/acem/136457

Publication type: original article

Language: English

License: Creative Commons Attribution 3.0 Unported (CC BY 3.0)

Download citation:

  • BIBTEX (JabRef, Mendeley)
  • RIS (Papers, Reference Manager, RefWorks, Zotero)

Cite as:


Wang W, Xiao C, Chen H, Li F, Xia D. Radiation induces submandibular gland damage by affecting Cdkn1a expression and regulating expression of miR-486a-3p in a xerostomia mouse model. Adv Clin Exp Med. 2021;30(9):933–939. doi:10.17219/acem/136457

Radiation induces submandibular gland damage by affecting Cdkn1a expression and regulating expression of miR-486a-3p in a xerostomia mouse model

Wei Wang1,B,C,D,E,F, Caizhi Xiao1,A,C,E,F, Hong Chen1,B,C,E,F, Fangfei Li1,B,C,F, Dongqin Xia1,B,C,E,F

1 Key Laboratory of Biorheological Science and Technology of the Ministry of Education (Chongqing University), Chongqing University Cancer Hospital, China

Abstract

Background. Radiotherapy has been proven to be an effective treatment strategy for inhibiting head-and-neck cancer. However, side effects are common when using high-dosage irradiation, and the mechanism of action of this therapy has not been fully clarified.

Objectives. To discover targeting molecules involved in an electron radiation-induced xerostomia murine model.

Materials and methods. The xerostomia model mice were divided into Gy-3 (n = 5), Gy-7 (n = 5), and Gy-21 (n = 5) groups, and were compared to a negative control (NC) group. Drinking water amount, saliva volume, submandibular gland weight, and body weight were recorded. Real-time polymerase chain reaction (RT-PCR) was performed to amplify gene transcription. Hematoxylin and eosin (H&E) staining was used to identify submandibular gland damage. The dual-luciferase assay was used to observe the interaction between the Cdkn1a gene and miR-486a-3p.

Results. Electron radiation significantly increased the drinking water amount, and decreased saliva volume and body weight compared to mice without radiation treatment (p < 0.05). The H&E staining showed that electron radiation damaged the submandibular gland. Electron radiation also triggered significantly higher transcription of the Cdkn1a gene in the submandibular gland of xerostomia mice compared to those without radiation treatment (p < 0.05). The dual-luciferase assay demonstrated that miR-486a-3p interacted with the Cdkn1a gene (miRNA-mRNA).

Conclusions. Radiation was found to induce damage of the submandibular gland and affect Cdkn1a expression by regulating the expression of miR-486a-3p in a xerostomia murine model. Therefore, modulation of miR-486a-3p and the Cdkn1a gene in a xerostomia murine model might improve damage of the submandibular gland.

Key words: xerostomia, electron radiation, miRNA-mRNA targeting interaction, miR-486a-3p, Cdkn1a

Background

Annually worldwide, about 500,000 patients are diagnosed with head-and-neck malignancies, and this tendency is increasing.1, 2 Radiotherapy has proven to be an effective strategy for treating head-and-neck cancer. However, side effects are common when using high-dosage irradiation3 and include xerostomia (a dry mouth caused by salivary gland damage). Usually, xerostomia influences life quality in patients with head-and-neck malignancy.4 However, no effective therapeutic regimens have been discovered for xerostomia until now.

In previous studies, plenty of specific mechanisms focusing on dysfunction of salivary glands in xerostomia animal models have been explored, such as necrosis and apoptosis.5, 6 To date, many studies have discovered that extracellular microRNAs (miRNAs) are involved in the pathogenic process of head-and-neck malignancy and the associated radiotherapy resistance.7, 8 Lamichhane et al. reported that circulating miRNAs act as prognostic molecular biomarkers for head-and-neck cancer.9 Fadhil et al. also proved that miRNAs could act as potential diagnostic biomarkers for human head-and-neck cancer.10 A previous study also reported that miR-486-5p is involved in the process of neurogenesis and neovascularization.11 Meanwhile, miR-486-5p is also correlated with pyroptosis or apoptosis, and involved in inflammatory diseases.12 Moreover, the Cdkn1a-encoded p21 molecule can interact with a series of molecules involved in many key biological processes.13 Thus, we speculated that Cdkn1a might interact with miR-486-5p.

Objectives

In this study, we hypothesized that miR-486-5p might participate in the pathogenesis of radiotherapy-induced xerostomia in an animal model. Therefore, this study aimed to discover targeting molecule involved in an electron radiation-induced xerostomia animal model.

Materials and methods

Animals and cells

A total of 20 specific-pathogen-free (SPF) C57BL/6J mice (Ensiweier Biotechnology Co. Ltd., Chongqing, China) were fed with ad libitum food and water, and housed in conditions with a light/dark cycle of 12 h/12 h at 23–25°C.

The Ethical Committee of Chongqing University Cancer Hospital (China) approved this study (approval No. CZLS2021077-A). All of the experiments were conducted in accordance with the Guidance of Care and Use of Laboratory Animals of the National Institutes of Health (NIH).

Xerostomia model generation and grouping

The mice were divided into a normal control (NC) group (n = 5) and an X-ray irradiation injury xerostomia model group (n = 15). Mice in the xerostomia model group were further subdivided into a 3-day electron radiation group (Gy-3 group, n = 5), a 7-day electron radiation group (Gy-7 group, n = 5) and a 21-day electron radiation group (Gy-21 group, n = 5). Mice in the irradiation injury xerostomia model groups were weighed, anesthetized and placed on a linear accelerator in a supine position (with energy of 9 mV and dosage of 3 Gy/min). The submandibular gland of mice was irradiated with a single dose of 18 Gy electron radiation. Mice in the NC group were treated with the same method as the radiation model groups, except for the irradiation.

Measurement of parameters

The drinking water amount was recorded. Saliva was collected and its volume was recorded. The submandibular gland was isolated from xerostomia mice and weighed. The submandibular gland index was calculated using the following formula (Equation 1):

RT-PCR assay

RNAs were extracted from submandibular gland tissues of xerostomia mice using the MiniBEST Universal RNA Extraction Kit (cat. No. 9767; TaKaRa, Tokyo, Japan) and cDNAs were synthesized with the PrimeScript II 1st Strand cDNA Synthesis Kit (cat. No. 6210A; TaKaRa) following the manufacturer’s instructions. Transcription of the Cdkn1a gene was examined with AceQ® qPCR SYBR Green Master Mix (cat. No. Q111-02; Vazyme, Shanghai, China) using the generated polymerase chain reaction (PCR) primers (Table 1). The gene transcriptional products were analyzed using a Tanon-1600 gel-scanning system (Tanon, Beijing, China) depending on the protocol of the scanning equipment. Finally, the relative gene transcriptions were evaluated using the previously described 2−ΔΔct method.14

Hematoxylin and eosin staining

Submandibular glands were fixed using 4% paraformaldehyde, dehydrated in ethanol at different gradients for transparency, embedded in paraffin, cut into 5-μm thick sections, and then stained with hematoxylin and eosin (H&E) as described by Zhou et al.15

Dual-luciferase reporter assay

293T cells were cultured in 24-well plates for 24 h and co-transfected using pmir-Glo-WtCdkn1a+pTK-NC and pmir-Glo-WtCdkn1a+pTK+mmu-miR-486a-3p or pmir-Glo-MuCdkn1a+pTK-NC and pmir-Glo-MuCdkn1a+pTK+mmu-miR-486a-3p. The transfections were carried out using LipofectamineTM 2000 (Thermo Fisher Scientific, Waltham, USA) as instructed by the manufacturer. About 48 h post-transfection, the dual-luciferase reporter assay system (Promega, Madison, USA) was applied to verify firefly luciferase normalized to Renilla luciferase (ratio).

Statistical analyses

Data are reported as mean ± standard deviation (SD) and analyzed using IBM SPSS Statistics for Windows v. 19.0 software (IBM Corp., Armonk, USA). The Mann–Whitney U test was used to analyze the differences between 2 groups. A value of p < 0.05 was considered to be a statistically significant difference.

Results

Electron radiation increased
the drinking amounts of xerostomia mice

Electron radiation greatly increased the drinking water amount in xerostomia mice compared to those in the NC group at 0 days (Figure 1A), 3 days (Figure 1B), 7 days (Figure 1C), and 21 days (Figure 1D) after radiation injury. These results suggest that electron radiation obviously increased the drinking water amount in xerostomia mice.

Electron radiation reduced
the body weight of xerostomia mice

At 3 days (Gy-3 group, Figure 2A, p = 0.016), 7 days (Gy-7 group, Figure 2B, p = 0.000) and 21 days (Gy-21 group, Figure 2C, p = 0.000) after the administration of electron radiation, the body weight of mice was significantly decreased compared to mice in the NC group. These results suggest that electron radiation reduced the body weight of xerostomia mice.

Electron radiation reduced the submandibular gland weight in xerostomia mice

The submandibular gland weight of xerostomia mice in the Gy-3, Gy-7 and Gy-21 groups was significantly reduced compared to the submandibular gland weight of mice in the NC group (Figure 3A, all p = 0.001) in a time-dependent manner. In addition, the submandibular gland index of xerostomia mice in the Gy-21 group was markedly decreased compared to the index in the NC group (Figure 3B, p = 0.000). However, there were no obvious changes in the submandibular gland index in the Gy-3 and Gy-7 groups compared with the NC group (Figure 3B, p = 0.963 and p = 0.357, respectively). Furthermore, the saliva volume of electron radiation-treated mice (Gy-3, Gy-7 and Gy-21 groups) was significantly lower compared to xerostomia mice in the NC group (Figure 3C, all p = 0.001).

Electron radiation damaged the submandibular gland structure in xerostomia mice

In the NC group, the glands could be seen, the nucleus was close to the base, arranged in an orderly manner, and blood vessels could be seen in the stroma (Figure 4). In the electron radiation-treated groups, the submandibular gland was atrophied, the number of cells was decreased, the structure of the gland tissue was loose, and the space between glandular lobules was enlarged (Figure 4).

Electron radiation triggered an increase in Cdkn1a gene transcription

The results of the bioinformatics and miRNA/mRNA association analysis (Kyoto Encyclopedia of Genes and Genomes (KEGG) information analysis) (http://www.genome.ad.jp/kegg/) showed that the targeting gene, ENSMUSG00000023067 (Cdkn1a), related to xerostomia, was enriched in the p53 signaling pathway. According to the real-time PCR (RT-PCR) findings, Cdkn1a gene transcription was significantly increased in mice in the radiation groups compared to mice in the NC group 3 days (p = 0.000), 7 days (p = 0.000) and 21 days (p = 0.000) after the electron radiation treatment (Figure 5). Therefore, we speculate that Cdkn1a might be involved in the pathogenesis of xerostomia.

miR-486a-3p interacted
with the Cdkn1a gene

As can be observed in Figure 6, mmu-miR-486a-3p regulated expression of luciferase in 3’-UTR of the Cdkn1a gene (p = 0.001). Therefore, mmu-miR-486a-3p effectively regulated the expression of luciferase through binding at 3’-UTR of the Cdkn1a gene.

Discussion

Head-and-neck cancer patients usually suffer from radiotherapy-induced dysfunction of the salivary glands.16 The submandibular gland secretes about 2/3 of the amount of unstimulated saliva.4, 17 Therefore, this study mainly focused on investigating the functions of the submandibular gland in xerostomia mice. Previous studies have reported that head-and-neck cancer patients undergoing radiotherapy treatment usually demonstrate decreased salivary secretion and damaged submandibular glands.18, 19 Thus, it is crucial to discover the specific mechanisms for radiation-induced submandibular gland dysfunction and identify the associated molecules.

In this study, we found that electron radiation markedly increased the drinking water amount, decreased saliva volume and body weight, and reduced submandibular gland weight and submandibular gland index of mice compared to those without electron radiation treatment. As shown by these results, the electron radiation-induced symptoms in mice are consistent with those in radiation-treated cancer patients.20 Based on the H&E staining results, it can be stated that electron radiation damaged the structure of the submandibular gland, resulting in an atrophied gland, decreased cell amounts, loose gland tissues, and enlarged spaces between glandular lobules. We believe that electron radiation might induce the death of cells in the submandibular gland tissues of mice.

According to the KEGG bioinformatics analysis, the Cdkn1a gene is highly expressed in submandibular gland tissues. Therefore, it was selected for the dual-luciferase reporter assay to observe the potential interaction with miR-486. As previous studies have documented, plenty of miRNAs have been discovered in the submandibular glands.21, 22 The miR-486 has been proven to participate in the apoptosis process of cells in different disorders. Luo et al. found that miR-486-5p promoted apoptosis in an acute lung injury animal model.23 Fan et al. reported that miR-486 reduction could protect cardiomyocytes against cell injury by inducing apoptosis.24 The miRNA/mRNA association analysis identified that, taking Cdkn1a as the targeting gene, miR-486 demonstrated the most remarkable change. Therefore, we analyzed the relationship between Cdkn1a and miR-486a-3p and found that miR-486a-3p interacts with Cdkn1a, which is a typical miRNA–mRNA targeting interaction.25

Limitations

Firstly, this study only clarified the interaction between miR-486a-3p and Cdkn1a in a xerostomia murine model. The downstream molecules involved in the pathological process have not been determined. Secondly, there might be other miRNAs or miRNA–mRNA targeting interactions that participate in the xerostomia process, which need to be investigated in future studies. Thirdly, this study mainly clarified the miRNA–mRNA targeting interaction between miR-486a-3p and the Cdkn1a gene. However, the endogenous expression of miR-486a-3p and the effects of radiation on miR-486a-3p expression have not been determined. Fourthly, this study is only a preliminary investigation of the effects of radiation on xerostomia and proved that miR-486a-3p is involved in the effects of radiation. However, whether a deficiency of miR-486a-3p could affect Cdkn1a expression has not been determined. Lastly, the sample size of this study is small (n = 5 for each group). Therefore, in a follow-up study, we plan to further clarify the specific mechanism for radiation-caused xerostomia in animal models.

Conclusions

Radiation induces damage of the submandibular gland and affects Cdkn1a expression by regulating the expression of miR-486a-3p in a xerostomia mouse model. Therefore, modulating miR-486a-3p and the Cdkn1a gene in a xerostomia murine model might reverse damage of the submandibular gland.

Tables


Table 1. Specific primers for the real-time polymerase chain reaction (RT-PCR) assay

Genes

Sequences (5’-3’)

GAPDH – forward

CAGAAGGGGCGGAGATGAT

GAPDH – reverse

AGGCCGGTGCTGAGTATGTC

Cdkn1a – forward

CCCGTGGACAGTGAGCAGTT

Cdkn1a – reverse

GCAGCAGGGCAGAGGAAGTA

Equations


Equation 1

Figures


Fig. 1. Effects of electron radiation on drinking water amount (mean ±SD) 0 days (A), 3 days (B), 7 days (C), and 21 days (D) after the radiation treatment (n = 5 for each group). The white and black bar charts represent the negative control (NC) group and Gy-treated groups, respectively. The p-values for comparisons between groups are shown in the images. df – degrees of freedom
Fig. 2. Electron radiation decreased the body weight (mean ±SD) of xerostomia mice 3 days (A), 7 days (B) and 21 days (C) after the radiation treatment (n = 5 for each group). The white and black bar charts represent the negative control (NC) group and Gy-treated groups, respectively. The p-values for comparisons between groups are shown in the images. df – degrees of freedom
Fig. 3. Effects of electron radiation on the submandibular gland weight (A), submandibular gland index (B), and saliva volume (C) of xerostomia mice (n = 5 for each group). All data are illustrated as mean ±SD. The white and black bar charts represent the negative control (NC) group and Gy-treated groups, respectively. The p-values for comparisons between groups are shown in the images. df – degrees of freedom
Fig. 4. Electron radiation damaged the structure of the submandibular gland, as determined with hematoxylin and eosin (H&E) staining (n = 5 for each group). NC – negative control
Fig. 5. Electron radiation triggered transcription changes of the Cdkn1a gene (n = 5 for each group). All data are illustrated as mean ±SD. The white and black bar charts represent the negative control (NC) group and Gy-treated groups, respectively. The p-values for comparisons between groups are shown in the images. df – degrees of freedom
Fig. 6. miR-486a-3p interacted with the Cdkn1a gene, as shown using the dual-luciferase assay. The p-values for comparisons between groups are shown in the images. df – degrees of freedom

References (25)

  1. Adesanya MR, Redman RS, Baum BJ, O’Connell BC. Immediate inflammatory responses to adenovirus-mediated gene transfer in rat salivary glands. Hum Gene Ther. 1996;7(9):1085–1093. doi:10.1089/hum.1996.7.9-1085
  2. Baum BJ, Zheng C, Cotrim AP, et al. Aquaporin-1 gene transfer to correct radiation-induced salivary hypofunction. Handb Exp Pharmacol. 2009;190:403–418. doi:10.1007/978-3-540-79885-9_20
  3. Emami B, Lyman J, Brown A, et al. Tolerance of normal tissue to therapeutic irradiation. Int J Radiat Oncol Biol Phys. 1991;21(1):109–122. doi:10.1016/0360-3016(91)90171-y
  4. Limesand KH, Said S, Anderson SM. Suppression of radiation-induced salivary gland dysfunction by IGF-1. PLoS One. 2009;4(3):e4663. doi:10.1371/journal.pone.0004663
  5. Pucar D, Groves MW, Biddinger P, Figueroa R, Williams HT. Head and neck cancer soft tissue radiation necrosis: Diagnostic challenge. Clin Nucl Med. 2019;44(2):e110–e112. doi:10.1097/RLU.0000000000002356
  6. Paardekooper GM, Cammelli S, Zeilstra LJ, Coppes RP, Konings AW. Radiation-induced apoptosis in relation to acute impairment of rat salivary gland function. Int J Radiat Biol. 1998;73(6):641–648. doi:10.1080/095530098141898
  7. Nowicka Z, Stawiski K, Tomasik B, Fendler W. Extracellular miRNAs as biomarkers of head and neck cancer progression and metastasis. Int J Mol Sci. 2019;20(19):4799. doi:10.3390/ijms20194799
  8. Jing X, Gao Z, Tian L, Liu M. Expressions of miR-122a and miR-3195 in laryngeal cancer and their effects on the proliferation and apoptosis of laryngeal cancer cell Hep-2. Adv Clin Exp Med. 2020;29(5):525–534. doi:10.17219/acem/118848
  9. Lamichhane SR, Thachil T, Gee H, Milic N. Circulating microRNAs as prognostic molecular biomarkers in human head and neck cancer: A systematic review and meta-analysis. Dis Markers. 2019;2019:8632018. doi:10.1155/2019/8632018
  10. Fadhil RS, Wei MQ, Nikolarakos D, Good D, Nair RG. Salivary microRNA miR-let-7a-5p and miR-3928 could be used as potential diagnostic bio-markers for head and meck squamous cell carcinoma. PLoS One. 2020;15(3):e0221779. doi:10.1371/journal.pone.0221779
  11. Dori M, Cavalli D, Lesche M, et al. MicroRNA profiling of mouse cortical prognostors and neurons reveals miR-486-5p as a regulator of neurogenesis. Development. 2020;147(9):dev190520. doi:10.1242/dev.190520
  12. Zhang C, Gong Y, Li N, et al. Long non-coding RNA Kcnq1to1 promotes cC5b-9-induced podocyte pyroptosis by inhibiting miR-486-3p and upregulating NLRP3. Am J Physiol Cell Physiol. 2020;320(3):C355–C364. doi:10.1152/ajpcell.00403.2020
  13. Follis AV, Galea CA, Kriwacki RW. Intrinsic protein flexibility in regulation of cell proliferation: Advantages for signaling and opportunities for novel therapeutics. Adv Exp Med Biol. 2012;725:27–49. doi:10.1007/978-1-4614-0659-4_3
  14. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔct method. Methods. 2001;25(4):402–408. doi:10.1006/meth.2001.1262
  15. Zhou ZH, Shi L, Lang MJ, Chen ZL, Wang YL, He S. Effect of fibroblast growth factor 1 on the proliferating cell nuclear antigen expression in submandibular gland of diabetic mice [in Chinese]. Zhonghua Kou Qiang Yi Xue Za Zhi. 2017;52(5):294–299. doi:10.3760/cma.j.issn.1002-0098.2017.05.007
  16. Strojan P, Hutcheson KA, Eisbruch A, et al. Treatment of late sequelae after radiotherapy for head and neck cancer. Cancer Treat Rev. 2017;59:79–92. doi:10.1016/j.ctrv.2017.07.003
  17. de Almeida PDV, Gregio AM, Machado MA, de Lima AA, Azevedo LR. Saliva composition and functions: A comprehensive review. J Contemp Dent Pract. 2008;9(3):72–80. PMID:18335122
  18. Jensen SB, Vissink A, Limesand KH, Reyland ME. Salivary gland hypofunction and xerostomia in head and neck radiation patients. J Natl Cancer Inst Monogr. 2019;2019(53):lgz016. doi:10.1093/jncimonographs/lgz016
  19. Almstahl A, Skoogh Andersson J, Alstad T, Fagerberg-Mohlin B, Finizia C. Explorative study on quality of life in relation to salivary secretion rate in head and neck cancer patients treated with radiotherapy up to 2 years post treatment. Int J Dent Hyg. 2019;17(1):46–54. doi:10.1111/idh.12363
  20. Uchiyama Y, Kreiborg S, Murakami S, Tsujimoto T, Sumida I. Changes in the submandibular gland in patients with head and neck cancer after resection therapy: A preliminary study. Anticancer Res. 2017;37(6):3239–3242. doi:10.21873/anticanres.11686
  21. Hayashi T, Koyama N, Azuma Y, Kashimata M. Mesenchymal miR-21 regulates branching morphogenesis in murine submandibular gland in vitro. Dev Biol. 2011;352(2):299–307. doi:10.1016/j.ydbio.2011.01.030
  22. Hayashi T, Koyama N, Gresik EW, Kashimata M. Detection of EGF-dependent microRNAs of the fetal mouse submandibular gland at embryonic day 13. J Med Invest. 2009;56(Suppl):250–252. doi:10.2152/jmi.56.250
  23. Luo Q, Zhu J, Zhang Q, Xie J, Yi C, Li T. MicroRNA-486-5p promotes acute lung injury via inducing inflammation and apoptosis by targeting OTUD7B. Inflammation. 2020;43(3):975–984. doi:10.1007/s10753-020-01183-3
  24. Fan J, Shi S, Qiu Y, Zhang Z, Yu L. MicroRNA-486-5p down-regulation protects cardiomyocytes against hypoxia-induced cell injury by targeting IGF-1. Int J Clin Exp Pathol. 2019;12(7):2544–2551. PMID:31934081
  25. Ma R, Wang C, Wang J, Wang D, Xu J. miRNA–mRNA interaction network in non-small cell lung cancer. Interdiscip Sci. 2016;8(3):209–219. doi:10.1007/s12539-015-0117-8