From discovery to implementation

Advances in Clinical and Experimental Medicine

Title abbreviation: Adv Clin Exp Med
Journal Impact Factor (JIF 2025) – 2.5
Journal Citation Indicator (JCI 2025) – 0.40
Scopus CiteScore (2025) – 4.2
Index Copernicus Value (ICV 2024) – 161.00
MNiSW – 70 pts
ISSN 1899–5276 (print), ISSN 2451-2680 (online)
Periodicity – monthly

Download original text (EN)

Advances in Clinical and Experimental Medicine

2021, vol. 30, nr 2, February, p. 139–146

doi: 10.17219/acem/130608

Publication type: original article

Language: English

License: Creative Commons Attribution 3.0 Unported (CC BY 3.0)

Download citation:

  • BIBTEX (JabRef, Mendeley)
  • RIS (Papers, Reference Manager, RefWorks, Zotero)

Cite as:


Li Y, Hu K, Liang M, et al. Stilbene glycoside upregulates SIRT3/AMPK to promotes neuronal mitochondrial autophagy and inhibit apoptosis in ischemic stroke. Adv Clin Exp Med. 2021;30(2):139–146. doi:10.17219/acem/130608

Stilbene glycoside upregulates SIRT3/AMPK to promotes neuronal mitochondrial autophagy and inhibit apoptosis in ischemic stroke

Yuxian Li1,A,D,E, Ke Hu1,A,D,E,F, Minghua Liang2,A,D,F, Qing Yan3,A,D,F, Minjiang Huang1,A,C, Ling Jin1,A,F, Yuefu Chen1,A,C, Xirong Yang4,A,B,C, Xiaobo Li5,A,D,E

1 School of Medicine, Hunan University of Medicine, Huaihua, China

2 Department of Pediatrics, First People’s Hospital of Huaihua, China

3 School of Nursing, Hunan University of Medicine, Huaihua, China

4 Department of Neurology, The First Affiliated Hospital of Hunan University of Medicine, Huaihua, China

5 Department of Neurology, The Third Xiangya Hospital, Central South University, Changsha, China

Abstract

Background. Ischemic stroke, also known as cerebrovascular accident or cerebral stroke, occupies the first place in the world’s top 10 causes of death, with high incidence, mortality and disability rates.

Objectives. To investigate the effect of stilbene glycoside upregulated SIRT3/AMPK expression on neuronal mitochondrial autophagy and neuronal apoptosis in ischemic stroke.

Material and methods. The PC12 cells were cultured without serum to construct an ischemic neuron model. The cells were divided into 6 groups: normal group (untreated cells), model group (ischemic treated cells), TSG group (stilbene glycoside treatment), NC group (SIRT3 and AMPK negative control treatment), si-SIRT3 group (SIRT3 silencing treatment), TSG+si-SIRT3 group (joint treatment), and TSG+si-SIRT3+oe-AMPK group (joint treatment). Cell survival and the expression of related molecules were detected.

Results. Compared with normal group, the model group had significantly decreased cell survival rate, mitochondrial membrane potential, as well as the expression of Bcl-2, LC3II/I, P62, PINK1, Parkin, SIRT3, AMPK, and p-AMPK, while showing significantly increased proportion of apoptosis and the expression of caspase 3 and Bax. Compared with the model group, TSG treatment promoted cell survival rate and mitochondrial autophagy, and inhibited apoptosis, while SIRT3 silencing treatment reduced cell survival rate and mitochondrial autophagy, and increased apoptosis. The SIRT3 silencing could block the inhibitory effect of TSG on the apoptosis of ischemic PC12 cells and promote mitochondrial autophagy, and AMPK overexpression could save the apoptosis of ischemic PC12 cells caused by SIRT3 silencing, and promote mitochondrial autophagy.

Conclusions. By promoting the expression of SIRT3/AMPK, TSG promotes mitochondrial autophagy in ischemic neurons and inhibits their apoptosis.

Key words: apoptosis, PC12 cells, mitochondrial, ischemic, sirtuin 3

Background

Ischemic stroke, also known as cerebrovascular accident or cerebral stroke, occupies the first place in the world’s top ten causes of death, with high incidence, mortality and disability rate.1, 2 The incidence of ischemic stroke in the elderly is very high, and there is a trend of increasing year by year, seriously threatening the life of patients in their later years.3, 4 Ischemic stroke affects the supply of oxygen, sugar and blood in some brain tissues, which leads to the destruction of corresponding brain tissues.5, 6

Current studies mainly consider inflammation, apoptosis, oxidative stress response and mitochondrial dysfunction of neurons as the main mechanisms of occurrence of ischemic stroke.7, 8, 9 At present, it is generally believed that apoptosis is the ultimate cause of ischemic stroke. After ischemic injury of neurons, on the one hand, caspase 3 can be activated to induce apoptosis,10 and on the other hand, Bcl-2 protein family can promote apoptosis by binding Bax and anti-apoptosis protein Bcl-2.11 Moreover, studies have found that autophagy occurs in neurons after ischemia and can maintain cell homeostasis through autophagy.12 Mitochondrial autophagy is one of the ways of autophagy.13

Stilbene glycoside is one of the ingredients extracted from Polygonum multiflorum.14 Current studies have shown that stilbene glycoside can improve ischemia-reperfusion injury by inhibiting neuronal apoptosis, and the development of ischemic stroke eventually leads to the occurrence of ischemia-reperfusion.15, 16 However, in ischemic stroke, the specific molecular mechanism of stilbene glycoside improving neuronal damage is not yet clear.

SIRT3 is a member of the NAD+-dependent class III histone deacetylase, and as a mitochondrial histone deacetylase, has a significant inhibitory effect on tumors.17 In addition, a study has shown that SIRT3 can activate downstream AMPK pathway after deacetylation.18, 19 AMPK is one of the typical protein kinases in eukaryotes and has a regulatory effect on mitochondrial autophagy.20 However, the mechanism of SIRT3/AMPK on apoptosis and mitochondrial autophagy in ischemic stroke is not yet clear.

Objectives

In this study, we cultured PC12 cells of rats and treated them with hypoxia to simulate neuronal ischemic injury in vitro, and explored the mechanism of stilbene glycoside effect on ischemic neuron injury through drug treatment and transfection.

Methods

Cell culture

Rat PC12 cells were cultured and purchased from the ATTC library (Manassas, USA). PC12 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM), in which 10% fetal bovine serum (FBS), 100 U/mL of penicillin and 100 mg/mL of streptomycin were added. The cells were cultured at 37°C and 5% CO2.

Grouping

The PC12 cells were divided into 6 groups: normal group (untreated cells), model group (ischemic-treated cells), NC group (SIRT3 and AMPK negative control treatment), TSG group (stilbene glycoside treatment), si-SIRT3 group (SIRT3 silencing treatment), TSG+si-SIRT3 group (joint treatment), and TSG+si-SIRT3+oe-AMPK group (SIRT3 silencing and AMPK overexpression joint treatment). The NC group, si-SIRT3 group, TSG+si-SIRT3 group, and TSG+si-SIRT3+oe-AMPK group were all transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, USA) 24 h before modeling. The transfection steps were conducted according to the operation instructions of the kit. In the TSG group, TSG+si-SIRT3 group and TSG+si-SIRT3+oe-AMPK group, 10 μm/L of stilbene glycoside (6 wells and 2 mL/well) was added to the medium for culture, and the cells of other groups were added with the same amount of dimethyl sulfoxide (DMSO). The TSG was purchased from Nanjing Senberga Biotechnology Co., Ltd. (Nanjing, China), and the rest of the vectors were prepared by Wuhan Jinkairui Biological Engineering Co., Ltd (Wuhan, China). The cells were collected by centrifugation at 350 g for 6 min. Then, the cells were washed twice with phosphate-buffered saline (PBS; sterile, pH 7.4). The normal group cells were resuspended and cultured in standard DMEM. The cells in other groups were resuspended in DMEM without glucose and cultured in air at 37°C, 5% CO2, 94% N2, and 1% O2 for 6 h under humid conditions. After 6 h of culture, the medium was replaced with standard DMEM to avoid the influence of secretions generated during the sugar-deficient treatment during the later experiment. The medium was then reoxygenated in a humid condition at 37°C, 5% CO2, and 95% air for 24 h. After centrifugation at 350 g for 6 min, cells were collected for subsequent experiments.

CCK-8 experiment

Cell proliferation was measured using a cell counting kit (Art. No. GM-040101-5; Dojindo, Gaithersburg, USA) according to kit instructions. Cells with logarithmic growth after transfection were taken, digested with trypsin, washed with PBS, and then suspended. Cells were transferred into 96-well plate by adjusting the cell concentration to 5 × 103 cells/μL. Each group was set up with 6 double-hole, the cells were placed in 37°C and 5% CO2 cell incubator, and cultured for 2 days continuously. For the last 4 h, 10 μL of CCK8 solution was added in each well. After 4 h of continuous culture, the optical density (OD) value was measured at the wavelength of 450 nm on a spectrophotometer (model UV-1800A; Shanghai Meixi Instrument Co., Ltd., Shanghai, China). The number of living cells in different treatment groups was estimated based on the OD value, and the cell survival rate was calculated. The experiment was repeated 3 times. The OD value was experimental group cell hole OD value after the subtraction of the blank hole cell OD value; the cell survival rate was the experimental hole OD value/parallel control hole OD value multiplied by 100%.

Flow cytometry

Cell apoptosis

The cells were collected 48 h after transfection and the cell concentration was adjusted to 1 × 106 cells/mL. Pre-cooled ethanol solution with a volume fraction of 70% was added to fix the cells, and then they were stored overnight at 4°C. After washing twice with PBS, 100 μL of cell suspension (no less than 106 cells/mL) was taken, and the cells were centrifuged and resuspended in 200 μL of binding buffer; then, 10 μL of Annexin V-FITC and 5 μL of PI were added and lightly mixed, and the mixture was kept out of light for 15 min at room temperature. Then, 300 μL of binding buffer was added. Apoptosis was detected using flow cytometry (Attune NxT; Thermo Fisher Scientific, Waltham, USA) at the excitation wavelength of 488 nm.

Mitochondrial membrane potential detection

PC12 cells were collected and washed with PBS once, and 1 mL of PBS was added. Then, 200 μL of JC-1 staining working solution were added and mixed well. The cells was incubated at 37°C for 20 min in cell incubator. Mito­chondrial membrane potential was detected with flow cytometry.

qRT-PCR

The total RNA of cells was extracted using Trizol. The primers were designed and synthesized by Shanghai Shenggong Biological Company (Shanghai, China; Table 1). The obtained RNA was reverse-transcripted into cDNA using PrimeScriPt RT kit (RR036A; TaKaRa Bio Inc., Kusatsu, Japan). The reverse transcriptional system was 10 μL with the reaction conditions as follows: 37°C for 15 min 3 times (reverse transcriptional reaction) and 85°C for 5 s. The fluorescent quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was performed according to the manufacturer’s instructions for SYBR® Premix Ex TaqTM II kit (RR820A; TaKaRa). The ABI7500 quantitative PCR instrument (7500; Applied Biosystems, Foster City, USA) was used for real-time quantitative PCR detection. The reaction conditions were: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, annealing extension at 60°C for 30 s, and cycling 40 times. The relative transcription levels of caspase 3, Bax, Bcl-2, SIRT3 and AMPK were calculated using the relative quantitative method (2−ΔΔCt method) and GAPDH was the internal reference primer:

and the relative transcription level = 2−ΔΔCt.

Western blot

The RIPA lysate containing phenylmethylsulfonyl fluoride (PMSF) was added to lysed cells and the total protein was obtained by centrifugation at 12,000 g for 10 min at 4°C. After protein quantitative detection, 50 μg of protein was separated with electrophoresis on a 10% SDS-PAGE gel and transferred to a polyvinylidene fluoride (PVDF) membrane. After being sealed with 5% skim milk at room temperature for 1 h, the PVDF membrane was rinsed with PBS for 2 min. The PVDF membrane was incubated with diluted primary antibody rabbit anti-caspase3 (ab133847; Abcam, Cambridge, USA), Bax (ab32503; Abcam), Bcl-2 (ab196495; Abcam), SIRT3 (ab189860; Abcam), AMPK (ab80039; Abcam), p-AMPK (ab23875; Abcam), LC3II/I (ab128025; Abcam), P62 (ab91526; Abcam), PINK1 (ab23707; Abcam), Parkin (ab233434; Abcam), and GAPDH (ab37168; Abcam) overnight at 4°C. After being washed with Tris-buffered saline with Tween 20 (TBST) 3 times, the PVDF membrane was incubated with 1:100 diluted horseradish peroxidase (HRP)-labeled secondary anti-goat anti-rabbit IgG antibody (ab150077; Abcam) for 1 h and washed with TBST 3 times for 10 min each. The membrane was developed using enhanced chemiluminescence (ECL) solution (ECL808-25; Biomiga, San Diego, USA). GAPDH was used as an internal reference, and the ratio of the gray value of the target band to the internal reference band was used as the relative expression of the protein. Each experiment was repeated 3 times.

Statistical analysis

Data analysis and processing were performed with SPSS v. 21.0 (IBM Corp., Armonk, USA) software. All measurement data was expressed as mean ± standard deviation (SD). Comparison between groups was performed with one-way analysis of variance (ANOVA) combined with post-hoc Bonferroni pairwise comparison test. The level of significant difference was set at p < 0.05.

Results

Cell proliferation in each group

To investigate the effects of stilbene glycoside and SIRT3/AMPK on ischemic neurons, cell viability in each group was measured using CCK-8. The results showed that compared with the normal group, the cell survival rates of model group were significantly decreased (p < 0.05). Compared with the model group, the cell survival rate of the TSG group was significantly higher, while that of the si-SIRT3 group was lower (p < 0.05), but there was no significant difference between the NC group and the TSG+si-SIRT3 group (p > 0.05). Compared with the TSG group, the cell survival rate of the TSG+si-SIRT3 group was lower. Compared with the TSG+si-SIRT3 group, the cell survival rate of the TSG+si-SIRT3+oe-AMPK group was significantly higher (p < 0.05; Figure 1).

Apoptosis in each group

The apoptosis rate of each group was detected using flow cytometry (Figure 2A,B), and the expression of apoptosis-related factors caspase 3, Bax and Bcl-2 at the molecular level were detected with qRT-PCR and western blot (Figure 2C–E). The results showed that compared with the normal group, the model group showed significantly increased apoptosis rate of cells, mRNA and protein expression of caspase 3 and Bax, and significantly decreased expression of Bcl-2 (p < 0.05). Compared with the model group, the TSG group had significantly decreased apoptosis rate and the mRNA and protein expression of caspase 3 and Bax, but significantly increased expression of Bcl-2; however, the si-SIRT3 group had opposite results in these indicators (p < 0.05), and there was no significant difference in these indicators between the TSG+si-SIRT3 group and si-SIRT3+oe-AMPK group (p > 0.05). Compared with the TSG group, the TSG+si-SIRT3 group had significantly increased apoptosis rate and expression of caspase 3 and Bax, but significantly decreased expression of Bcl-2 (p < 0.05). Compared with the TSG+si-SIRT3 group, the TSG+si-SIRT3+oe-AMPK group had significantly decreased apoptosis rate and the expression of caspase 3 and Bax, and significantly increased expression of Bcl-2 (p < 0.05).

Mitochondrial autophagy in each group

The changes of mitochondrial membrane potential in each group were detected using flow cytometry (Figure 3A,B). The protein expression of autophagy-related genes LC3II/I, P62 and mitochondrial autophagy genes PINK1 and Parkin were detected with western blot (Figure 3C,D). Compared with the normal group, the model group had significantly reduced mitochondrial membrane potentials and the protein expression of LC3II/I, P62, PINK1, and Parkin (p < 0.05). Compared with the model group, these indices were significantly increased in the TSG group, but significantly decreased in the si-SIRT3 group (p < 0.05), and there was no significant difference in each index of cells between the NC group and the TSG+si-SIRT3 group (p > 0.05). Compared with the TSG group, these indices were significantly reduced in the TSG+si-SIRT3 group (p < 0.05). Compared with TSG+si-SIRT3 group, these indices were significantly increased in the TSG+si-SIRT3+oe-AMPK group (p < 0.05).

Expression of SIRT3/AMPK
signaling pathway

The expression of SIRT3, AMPK and p-AMPK in each group was detected with qRT-PCR and western blot (Figure 4). The results showed that the expression of SIRT3, AMPK and p-AMPK in the model group was significantly lower than in the normal group (p < 0.05). Compared with the model group, the expression of SIRT3, AMPK and p-AMPK was significantly increased in the TSG group, while the si-SIRT3 group had significantly decreased expression of SIRT3 and p-AMPK (p < 0.05) and similar expression of AMPK (p > 0.05). Compared with TSG group, the TSG+si-SIRT3 group showed significantly decreased expression of SIRT3 and p-AMPK (p < 0.05), and similar expression of AMPK (p > 0.05). Compared with TSG+si-SIRT3 group, there was no significant difference in the expression of SIRT3 in TSG+si-SIRT3+oe-AMPK group (p > 0.05), and the expression of AMPK and p-AMPK was significantly increased (p < 0.05).

Discussion

At present, studies have shown that stilbene glycoside exerts an improving effect on cerebral ischemia-reperfusion injury, and can inhibit neuronal apoptosis by affecting the expression of related proteins in the brain, thus protecting neurons in the brain.21, 22 In this study, PC12 cells were treated with stilbene glycoside after 12 h of starvation treatment in a serum-free environment. The results showed that the apoptosis of PC12 cells treated with stilbene glycoside was significantly decreased, while the mitochondrial membrane potential and mitochondrial autophagy were significantly increased. This suggests that stilbene glycoside can significantly alleviate the ischemic injury of neurons.

It is generally believed that SIRT3 is related to energy metabolism and cellular oxidation.23 It can regulate adenosine triphosphate (ATP) production and affect mitochondrial membrane potential, and then inhibit apoptosis.24 Other studies have shown that SIRT3 can inhibit apoptosis by inhibiting Bax translocation. After SIRT3 deacetylation, the phosphorylation level of AMPK was not affected.25, 26 The AMPK, on the one hand, can accelerate the removal of reactive oxygen species (ROS) by reducing their formation, and improve the body environment; on the other hand, it can activate the expression of Bcl-2 and inhibit apoptosis.27 In this study, we also confirmed that in ischemic-injured PC12 cells, after SIRT3 silencing, the cell survival rate was significantly decreased, the apoptosis rate was significantly increased and the mitochondrial autophagy was significantly decreased. Moreover, after the overexpression of AMPK, ischemic injury can be partially saved by reducing apoptosis and promoting mitochondrial autophagy. These results indicate that SIRT3/AMPK can promote mitochondrial autophagy and improve neuronal damage by inhibiting apoptosis.

In view of the similar effects of stilbene glycoside and SIRT3/AMPK on ischemic neurons, we speculated whether there was a regulatory relationship between stilbene glycoside and SIRT3/AMPK. We detected SIRT3/AMPK expression in model group and TSG group, and found that SIRT3 and p-AMPK expression in cells treated with stilbene glycoside were significantly increased. In order to further explore the regulatory relationship between stilbene glycoside and SIRT3/AMPK, we treated PC12 cells with both stilbene glycoside and SIRT3 silencing, and compared them with the group treated with stilbene glycoside alone. The results showed that after the joint treatment of stilbene glycoside and SIRT3 silencing, the cell survival rate was decreased, the apoptosis rate was increased and the mitochondrial autophagy was decreased. Moreover, there was no significant difference in the cell survival rate and apoptosis rate between them and the untreated ischemic PC12 cells. This suggests that SIRT3 can block the improvement effect of stilbene glycoside on ischemic neurons.

Conclusions

We found that stilbene glycoside can promote the expression of SIRT3/AMPK, thereby inhibiting the apoptosis of ischemic neurons, promoting mitochondrial autophagy and achieving the effect of improving neuron damage. On the one hand, this study shed more light on the pathogenesis of ischemic stroke and the influence mechanism of stilbene glycoside in ischemic stroke; on the other hand, it also clarified the effect of SIRT3/AMPK on mitochondrial autophagy and the effect of mitochondrial autophagy on neurons. However, we found that SIRT3 silencing did not completely block the improvement effect of stilbene glycosides on ischemic neurons, which means that stilbene glycosides can also improve ischemic neuron damage by affecting the expression of other factors. A study has shown that AMPK can regulate mitochondrial autophagy by regulating ULK1,28 but in this research, we did not study its specific mechanism in detail. Therefore, the regulatory mechanism of SIRT3/AMPK on mitochondrial autophagy in ischemic stroke is not yet clear.

Tables


Table 1. Primer sequences

Name

Sequence (5’-3’)

Caspase 3

F: AGTTGACGCTAAGCCAGACC

R: GCAGATCCTGCATCTTTGCG

Bax

F: TGGCGATGAACTGGACAACA

R: CACGGAAGAAGACCTCTCGG

Bcl-2

F: CCTCCCCAAACTGCTCAAGT

R: TCAGCTCCATGGCTAGTGCT

SIRT3

F: CCTGTCTGTACTGGCGTTGT

R: GGACTCAGAGCAAAGGACCC

AMPK

F: ATGACAACCACCACGGAGAT

R: AGAGAAGAGTCGGGAGACCC

GAPDH

F: TGTGAACGGATTTGGCCGTA

R: GATGGTGATGGGTTTCCCGT

Figures


Fig. 1. Statistical results of cell viability in each group
*p < 0.05 – compared with the normal group; #p < 0.05 – compared with the model group; &p < 0.05 – compared with the NC group; $p < 0.05 – compared with the TSG group; @p < 0.05 – compared with the si-SIRT3 group; Dp < 0.05 – compared with the TSG+si-SIRT3 group.
Fig. 2. Effects of stilbene glycoside and SIRT3/AMPK on ischemic neuron apoptosis. A. Flow cytometry. B. Statistical results of apoptosis rate in each group. C. qRT-PCR detetion of mRNA expression of apoptosis-related factors in each group. D. Western blot. E. Protein expression of apoptosis-related factors in each group
*p < 0.05 – compared with the normal group; #p < 0.05 – compared with the model group; &p < 0.05 – compared with the NC group; $p < 0.05 – compared with the TSG group; @p < 0.05 – compared with the si-SIRT3 group; Dp < 0.05 – compared with the TSG+si-SIRT3 group.
Fig. 3. Effect of stilbene glycoside and SIRT3/AMPK on ischemic neuron autophagy. A. Flow cytometry. B. Statistical results of mitochondrial membrane potential in each group. C. Western blot. D. Protein expression of autophagy marker factor and mitochondrial autophagy marker factor in each group
*p < 0.05 – compared with the normal group; #p < 0.05 – compared with the model group; &p < 0.05 – compared with the NC group; $p < 0.05 – compared with the TSG group; @p < 0.05 – compared with the si-SIRT3 group; Dp < 0.05 – compared with the TSG+si-SIRT3 group.
Fig. 4. SIRT3/AMPK signaling pathway expression in each group. A. qRT-PCR detection of mRNA expression of SIRT3/AMPK signaling pathway factor in each group. B. Western blot. C. Protein expression of SIRT3/AMPK signaling pathway factor in each group
*p < 0.05 – compared with the normal group; #p < 0.05 – compared with the model group; &p < 0.05 – compared with the NC group; $p < 0.05 – compared with the TSG group; @p < 0.05 – compared with the si-SIRT3 group; Dp < 0.05 – compared with the TSG+si-SIRT3 group.

References (28)

  1. Khoshnam SE, Winlow W, Farzaneh M, Farbood Y, Moghaddam HF. Pathogenic mechanisms following ischemic stroke. Neurol Sci. 2017;38(7):1167–1186. doi:10.1007/s10072-017-2938-1
  2. Chen J, Cui C, Yang X, et al. MiR-126 affects brain–heart interaction after cerebral ischemic stroke. Transl Stroke Res. 2017;8(4):374–385. doi:10.1007/s12975-017-0520-z
  3. Adams RJ, Cox M, Ozark SD, et al. Coexistent sickle cell disease has no impact on the safety or outcome of lytic therapy in acute ischemic stroke. Stroke. 2017;48(3):686–691. doi:10.1161/STROKEAHA.116.015412
  4. Liu W, Wu J, Huang J, et al. Electroacupuncture regulates hippocampal synaptic plasticity via miR-134-mediated LIMK1 function in rats with ischemic stroke. Neural Plast. 2017;2017:9545646. doi:10.1155/2017/9545646
  5. Tuo QZ, Lei P, Jackman KA, Li XL, Bush AI. Tau-mediated iron export prevents ferroptotic damage after ischemic stroke. Mol Psychiatry. 2017;22(11):1520–1530. doi:10.1038/mp.2017.171
  6. Maier O, Menze BM, von der Gablentz J, et al. ISLES 2015: A public evaluation benchmark for ischemic stroke lesion segmentation from multispectral MRI. Med Image Anal. 2016;35:250–269. doi:10.1016/j.media.2016.07.009
  7. Feng D, Wang B, Wang L, et al. Pre-ischemia melatonin treatment alleviated acute neuronal injury after ischemic stroke by inhibiting endoplasmic reticulum stress-dependent autophagy via PERK and IRE1 signaling. J Pineal Res. 2017;62(3):e12395. doi:10.1111/jpi.12395
  8. Shireman TI, Wang K, Saver JL. Cost-effectiveness of solitaire stent retriever thrombectomy for acute ischemic stroke: Results from the SWIFT-PRIME trial (Solitaire With the Intention for Thrombectomy as Primary Endovascular Treatment for Acute Ischemic Stroke). Stroke. 2017;48(2):379–387. doi:10.1161/STROKEAHA.116.014735
  9. Ren C, Fu J, Wang H. Effect of early rehabilitation clinical pathway on ischemic stroke patients: A randomized controlled trial. Chin J Rehabil Med. 2017;32(3):275–282.
  10. Xue J, Huang W, Chen X, Li Q, Shao B. Neutrophil-to-lymphocyte ratio is a prognostic marker in acute ischemic stroke. J Stroke Cerebrovasc Dis. 2016;26(3):650–657. doi:10.1016/j.jstrokecerebrovasdis.2016.11.010
  11. Hu X, De Silva TM, Chen J, Faraci FM. Cerebral vascular disease and neurovascular injury in ischemic stroke. Circ Res. 2017;120(3):449–471. doi:10.1161/CIRCRESAHA.116.308427
  12. Yang Y, Yang LY, Orban L, et al. Non-invasive vagus nerve stimulation reduces blood–brain barrier disruption in a rat model of ischemic stroke. Brain Stimul. 2018;11(4):689–698. doi:10.1016/j.brs.2018.01.034
  13. Jampathong N, Laopaiboon M, Rattanakanokchai S, Pattanittum P. Prognostic models for complete recovery in ischemic stroke: A systematic review and meta-analysis. BMC Neurol. 2018;18(1):26. doi:10.1186/s12883-018-1032-5
  14. Chen X, Tang K, Peng Y, Xu X. 2,3,4’,5-tetrahydroxystilbene-2-O-β-d-glycoside attenuates atherosclerosis in apolipoprotein E-deficient mice: role of reverse cholesterol transport. Can J Physiol Pharmacol. 2018;96(1):8–17. doi:10.1139/cjpp-2017-0474
  15. Yu J, Li X, Matei N, McBride D, et al. Ezetimibe, a NPC1L1 inhibitor, attenuates neuronal apoptosis through AMPK dependent auto­phagy activation after MCAO in rats. Exp Neurol. 2018;307:12–23. doi:10.1016/j.expneurol.2018.05.022
  16. Li XY, Lu SS, Wang HL. Effects of the fenugreek extracts on high-fat diet-fed and streptozotocin-induced type 2 diabetic mice. Animal Model Exp Med. 2018;1(1):68–73. doi:10.1002/ame2.12004
  17. Chen T, Dai S, Li X, et al. Sirt1-Sirt3 axis regulates human blood–brain barrier permeability in response to ischemia. Redox Biol. 2018;14:229–236. doi:10.1016/j.redox.2017.09.016
  18. Liu SG, Wang YM, Zhang YJ, et al. ZL006 protects spinal cord neurons against ischemia-induced oxidative stress through AMPK-PGC-1α-Sirt3 pathway. Neurochem Int. 2017;108:230–237. doi:10.1016/j.neuint.2017.04.005
  19. Hao Z, Luo Y, Chen L, et al. Sirt3 inhibits cerebral ischemia-reperfusion injury through normalizing Wnt/β-catenin pathway and blocking mitochondrial fission. Cell Stress Chaperones. 2018;23(5):1079–1092. doi:10.1007/s12192-018-0917-y
  20. Zeng J, Liu W, Fan YZ, He DL, Li L. PrLZ increases prostate cancer docetaxel resistance by inhibiting LKB1/AMPK-mediated autophagy. Theranostics. 2018;8(1):109–123. doi:10.7150/thno.20356
  21. Du H, Ma L, Chen G, Li S. The effects of oxyresveratrol abrogates inflammation and oxidative stress in rat model of spinal cord injury. Mol Med Rep. 2017(3):4067–4073. doi:10.3892/mmr.2017.8294
  22. Duan Q, Xu Y, Marck PV, Kalisz J, Morgan EE, Pierre SV. Preconditioning and postconditioning by cardiac glycosides in the mouse heart. J Cardiovasc Pharmacol. 2018;71(2):95–103. doi:10.1097/FJC.0000000000000549
  23. Zheng Y, Shi B, Ma M, Wu X, Lin X. The novel relationship between Sirt3 and autophagy in myocardial ischemia-reperfusion. J Cell Physiol. 2019;234(5):5488–5495. doi:10.1002/jcp.27329
  24. Zhai M, Li B, Duan W, et al. Melatonin ameliorates myocardial ischemia reperfusion injury through SIRT3-dependent regulation of oxidative stress and apoptosis. J Pineal Res. 2017;63(2). doi:10.1111/jpi.12419
  25. Zhao XL, Yu CZ. Vosaroxin induces mitochondrial dysfunction and apoptosis in cervical cancer HeLa cells: Involvement of AMPK/Sirt3/HIF-1 pathway. Chem Biol Interact. 2018;290:57–63. doi:10.1016/j.cbi.2018.05.011
  26. Duan WJ, Li YF, Liu FL, et al. A SIRT3/AMPK/autophagy network orchestrates the protective effects of trans-resveratrol in stressed peritoneal macrophages and RAW 264.7 macrophages. Free Radic Biol Med. 2016;95:230–242. doi:10.1016/j.freeradbiomed.2016.03.022
  27. Gwon DH, Hwang TW, Ro JY, et al. High endogenous accumulation of ω-3 polyunsaturated fatty acids protect against ischemia-reperfusion renal injury through AMPK-mediated autophagy in fat-1 mice. Int J Mol Sci. 2017;18(10):2081. doi:10.3390/ijms18102081
  28. Kim J, Kundu M, Viollet B, Guan KL. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol. 2011;13(2):132–141. doi:10.1038/ncb2152