Advances in Clinical and Experimental Medicine

Title abbreviation: Adv Clin Exp Med
JCR Impact Factor (IF) – 1.727
Index Copernicus  – 166.39
MEiN – 70 pts

ISSN 1899–5276 (print)
ISSN 2451-2680 (online)
Periodicity – monthly

Download original text (EN)

Advances in Clinical and Experimental Medicine

Ahead of print

doi: 10.17219/acem/146775

Publication type: original article

Language: English

License: Creative Commons Attribution 3.0 Unported (CC BY 3.0)

Download citation:

  • BIBTEX (JabRef, Mendeley)
  • RIS (Papers, Reference Manager, RefWorks, Zotero)

Cite as:


Tyczewska M, Szyszka M, Jopek K, Ruciński M. Effects of Galp and alarin peptides on HPA axis gene expression and adrenal function: In vivo experiments [published online as ahead of print on March 11, 2022]. Adv Clin Exp Med. 2022. doi:10.17219/acem/146775

Effects of Galp and alarin peptides on HPA axis gene expression and adrenal function: In vivo experiments

Marianna Tyczewska1,A,B,C,D,E,F, Marta Szyszka1,B,C,F, Karol Jopek1,B,C,F, Marcin Ruciński1,A,E,F

1 Department of Histology and Embryology, Poznan University of Medical Sciences, Poland

Abstract

Background. Many experimental data indicate interactions between peptides involved in the control of food intake, energy homeostasis and adrenocortical hormone release. Glucocorticoids stimulate or inhibit the secretion of orexigenic and anorexigenic peptides, which in turn are involved in the regulation of adrenal growth, structure and function. Galanin-like peptide (Galp) and alarin (Ala) are involved in the regulation of food intake. Galp and Ala mRNAs have already been shown to be present in the arcuate nucleus (ARC) of the hypothalamus in both rats and mice.
Objectives. To investigate the expression of Ala, Galp and their receptors in the hypothalamus and pituitary and adrenal glands of the rat hypothalamic–pituitary–adrenal (HPA) axis after intraperitoneal administration of peptides in vivo.
Material and Methods. Experimental in vivo models were used: acute and long-term exposure to peptides.
Results. The expression of Galp, Ala, their receptors, and steroidogenesis enzymes was analyzed using quantitative real-time polymerase chain reaction (qRT-PCR). Statistically significant expression changes were found in the hypothalamus and pituitary after 1-hour exposure to the peptides, such as a decrease in corticotropin-releasing hormone (CRH) expression after Ala, Galp and adrenocorticotropic hormone (ACTH) administration, and a decrease in the expression of receptors for galanin (Gal) (Galr1 and Galr2). In the pituitary, there was a statistically significant increase in the expression of Ala, Galr1, Galr2, and Galr3 receptors 1 h after Galp administration. In the adrenal glands, only a statistically significant decrease in Galr2 expression was observed after 1 h of Ala 0.5 administration. The mRNA expression of steroidogenesis enzymes also changed: for example, the expression of cholesterol desmolase increased 24 h after Ala peptide administration.
Conclusion. The results indicate that the peptides tested under in vivo conditions can alter the expression of the peptides tested, as well as of Galp, Ala and Gal receptors and steroidogenesis enzymes – Cyp11a1 (cholesterol desmolase), Cyp11b1 (11β-hydroxylase) and Cyp11b2 (aldosterone synthase).

Key words

adrenal gland, HPA axis, Galp, alarin (Ala), in vivo experiments

Tables


Table 1. Conventional qRT-PCR analyses of CRH. Oligonucleotide sequences for sense (S) and antisense (A) primers are shown. Hypoxanthine phosphorybosyl transferase (Hprt) was the reference gene

cDNA

Genbank

accession number

Primer

Primer sequence (5’-3’)

Position

PCR product size (bp)

CRH

NM_031019.1

S

A

GTACCTCGCAGAACAACAGT

CTTCACCCATGCGGATCAGA

113–132

340–359

247

POMC

NM_139326.2

S

A

TCACCACGGAAAGCAACCTG

CATGACGTACTTCCGGGGAT

231–250

339–358

128

Ala

NM_022633.1

S

A

TGCTCACAGGGGACGAGGA

CCGGAACATTCTTGTCCAC

200–218

429–447

248

Alarin

NM_022633.1

S

A

ACAGGTCCTCCACCTTTCC

CATTGACCTTTTGGTCATCCTTGG

205–233

314–337

133

Galr1

NM_012958.3

S

A

TTCATCGGGACAGCAACCA

GCCAAATACCACAACGACCA

755–774

974–994

239

Galr2

NM_019172.5

S

A

CATCCTGTGCTGCGTGCC

CTAGCCCCCAGATGAGCCC

251–269

468–487

236

Galr3

NM_019173.1

S

A

AGGACTGAGGAAGATGGCTGA

ATTGCCCACCATGCCCAAC

13–34

112–131

118

Cyp11a1

NM_017286

S

A

GATGACCTATTCCGCTTTGC

GTTGGCCTGGATGTTCTTG

592–611

930–948

357

Cyp11b1

NM_012537

S

A

AGAGTATCCTCCCGCATCG

GCCAGTCTGCCCCATTTAG

311–329

394–412

102

Cyp11b2

NM_012538.2

S

A

TGGCAGCACTAATAACTCAGG

AAAAGCCACCAACAGGGTAG

875–895

1131–1150

276

Hprt

NM_012583

S

A

CAGTCAACGGGGGACATAAAAG

ATTTTGGGGCTGTACTGCTTGA

391–412

515–536

146
qRT-PCR – quantitative real-time polymerase chain reaction; CRH – corticotropin-releasing hormone; POMC – proopiomelanocortin; Ala – alarin; Galp – galanin-like peptide; Galr1 – galanin receptor type 1; Galr2 – galanin receptor type 2; Galr3 – galanin receptor type 3; Cyp11a1 – cholesterol desmolase; Cyp11b1 – 11β-hydroxylase; Cyp11b2 – aldosterone synthase.

Figures


Fig. 1. Relative mRNA expression of the galanin-like peptide (Galp), alarin (Ala) and mRNA receptors in the hypothalamus after the administration of the peptides (Galp/Ala, 1 h, 24 h and 2 days). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to determine the mRNA expression levels. Data points were presented as medians, 1st and 3rd quartiles (boxes) and ranges (whiskers – minimal and maximal values without outliers). Statistical analysis of the data was performed using the Kruskal–Wallis test and Dunn’s post hoc test. Different letters in the graphs indicate significant differences between specific groups. Outliers were also presented on the graphs. Statistical differences detected with post hoc test were indicated with letters, where different letters correspond to statistical significance (p < 0.05) between groups.
ACTH – adrenocorticotropic hormone; DMSO – dimethyl sulfoxide; Galr – galanin receptor.
Fig. 2. Relative mRNA expression of the galanin-like peptide (Galp), alarin (Ala) and mRNA receptors in the pituitary gland after the administration of the peptides (Galp/Ala, 1 h, 24 h and 2 days). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to determine the mRNA expression levels. Data points were presented as medians, 1st and 3rd quartiles (boxes) and ranges (whiskers – minimal and maximal values without outliers). Statistical analysis of the data was performed using the Kruskal–Wallis test and Dunn’s post hoc test. Different letters in the graphs indicate significant differences between specific groups. Outliers were also presented on the graphs. Statistical differences detected with post hoc test were indicated with letters, where different letters correspond to statistical significance (p < 0.05) between groups.
ACTH – adrenocorticotropic hormone; DMSO – dimethyl sulfoxide; Galr – galanin receptor.
Fig. 3. Relative mRNA expression of the corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) mRNAs after the administration of the peptides (galanin-like peptide (Galp)/alarin (Ala), 1 h, 24 h and 2 days). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to determine the mRNA expression levels. Data points were presented as medians, 1st and 3rd quartiles (boxes) and ranges (whiskers – minimal and maximal values without outliers). Statistical analysis of the data was performed using the Kruskal–Wallis test and Dunn’s post hoc test. Different letters in the graphs indicate significant differences between specific groups. Outliers were also presented on the graphs. Statistical differences detected with post hoc test were indicated with letters, where different letters correspond to statistical significance (p < 0.05) between groups.
ACTH – adrenocorticotropic hormone; DMSO – dimethyl sulfoxide.
Fig. 4. Relative mRNA expression of the galanin-like peptide (Galp), alarin (Ala) and receptors mRNAs in the adrenal gland after the administration of the peptides (Galp/Ala, 1 h, 24 h and 2 days). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to determine the mRNA expression levels. Data points were presented as medians, 1st and 3rd quartiles (boxes) and ranges (whiskers – minimal and maximal values without outliers). Statistical analysis of the data was performed using the Kruskal–Wallis test and Dunn’s post hoc test. Different letters in the graphs indicate significant differences between specific groups. Outliers were also presented on the graphs. Statistical differences detected with post hoc test were indicated with letters, where different letters correspond to statistical significance (p < 0.05) between groups.
ACTH – adrenocorticotropic hormone; DMSO – dimethyl sulfoxide; Galr – galanin receptor.
Fig. 5. Relative mRNA expression of the Cyp11a1, Cyp11b1 and Cyp11b2 mRNAs in the adrenal gland after the administration of the peptides (galanin-like peptide (Galp)/alarin (Ala), 1 h, 24 h and 2 days). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to determine the mRNA expression levels. Data points were presented as medians, 1st and 3rd quartiles (boxes) and ranges (whiskers – minimal and maximal values without outliers). Statistical analysis of the data was performed using the Kruskal–Wallis test and Dunn’s post hoc test. Different letters in the graphs indicate significant differences between specific groups. Outliers were also presented on the graphs. Statistical differences detected with post hoc test were indicated with letters, where different letters correspond to statistical significance (p < 0.05) between groups.
ACTH – adrenocorticotropic hormone; DMSO – dimethyl sulfoxide; Cyp11a1 – cholesterol desmolase; Cyp11b1 – 11β-hydroxylase; Cyp11b2 – aldosterone synthase.
Fig. 6. Level of corticosterone and ACTH in blood after peptides administration (galanin-like peptide (Galp)/alarin (Ala), 1 h, 24 h and 2 days). The analysis was performed with enzyme-linked immunosorbent assay (ELISA). Data points were presented as medians, 1st and 3rd quartiles (boxes) and ranges (whiskers – minimal and maximal values without outliers). Statistical analysis of the data was performed using the Kruskal–Wallis test and Dunn’s post hoc test. Different letters in the graphs indicate significant differences between specific groups
ACTH – adrenocorticotropic hormone; DMSO – dimethyl sulfoxide.

References (38)

  1. Mazzocchi G, Malendowicz LK, Rebuffat P, Nussdorfer GG. Effects of galanin on the secretory activity of the rat adrenal cortex: In vivo and in vitro studies. Res Exp Med (Berl). 1992;192(6):373–381. doi:10.1007/BF02576294
  2. Malendowicz LK, Nussdorfer GG, Nowak KW, Mazzocchi G. The possible involvement of galanin in the modulation of the function of rat pituitary–adrenocortical axis under basal and stressful conditions. Endocr Res. 1994;20(3):307–317. doi:10.1080/07435809409035866
  3. Ruciński M, Ziółkowska A, Szyszka M, Malendowicz LK. Cerebellin and des-cerebellin exert ACTH-like effects on corticosterone secretion and the intracellular signaling pathway gene expression in cultured rat adrenocortical cells: DNA microarray and QPCR studies. Int J Mol Med. 2009;23(4):539–546. doi:10.3892/ijmm_00000162
  4. Jones PM, O’Halloran DJ, Ghatei MA, Domin J, Bloom SR. The influence of adrenal hormone status on neuroendocrine peptides in the rat anterior pituitary gland. J Endocrinol. 1990;127(3):437–444. doi:10.1677/joe.0.1270437
  5. White BD, Dean RG, Martin RJ. Adrenalectomy decreases neuropeptide Y mRNA levels in the arcuate nucleus. Brain Res Bull. 1990;25(5):711–715. doi:10.1016/0361-9230(90)90047-4
  6. Neri G, Andreis PG, Nussdorfer GG. Effects of neuropeptide-Y and substance-P on the secretory activity of dispersed zona-glomerulosa cells of rat adrenal gland. Neuropeptides. 1990;17(3):121–125. doi:10.1016/0143-4179(90)90074-9
  7. Tortorella C, Neri G, Nussdorfer GG. Galanin in the regulation of the hypothalamic–pituitary–adrenal axis (Review). Int J Mol Med. 2007;19(4):639–647. doi:10.3892/ijmm.19.4.639
  8. Tyczewska M, Milecka P, Szyszka M, et al. Expression profile of Galp, alarin and their receptors in rat adrenal gland. Adv Clin Exp Med. 2019;28(6):737–746. doi:10.17219/acem/95039
  9. Belloni AS, Malendowicz LK, Ruciński M, Guidolin D, Nussdorfer GG. Galanin stimulates cortisol secretion from human adrenocortical cells through the activation of galanin receptor subtype 1 coupled to the adenylate cyclase-dependent signaling cascade. Int J Mol Med. 2007;20(6):859–864. doi:10.3892/ijmm.20.6.859
  10. Andreis PG, Malendowicz LK, Rebuffat P, Spinazzi R, Ziółkowska A, Nussdorfer GG. Galanin enhances corticosterone secretion from dispersed rat adrenocortical cells through the activation of GAL-R1 and GAL-R2 receptors coupled to the adenylate cyclase-dependent signaling cascade. Int J Mol Med. 2007;19(1):149–155. doi:10.3892/ijmm.19.1.149
  11. Lawrence CB, Baudoin FM, Luckman SM. Centrally administered galanin-like peptide modifies food intake in the rat: A comparison with galanin. J Neuroendocrinol. 2002;14(11):853–860. doi:10.1046/j.1365-2826.2002.00846.x
  12. Leibowitz SF. Regulation and effects of hypothalamic galanin: Relation to dietary fat, alcohol ingestion, circulating lipids and energy homeostasis. Neuropeptides. 2005;39(3):327–332. doi:10.1016/j.npep.2004.12.022
  13. Ohtaki T, Kumano S, Ishibashi Y, et al. Isolation and cDNA cloning of a novel galanin-like peptide (GALP) from porcine hypothalamus. J Biol Chem. 1999;274(52):37041–37045. doi:10.1074/jbc.274.52.37041
  14. Lang R, Berger A, Santic R, et al. Pharmacological and functional characterization of galanin-like peptide fragments as potent galanin receptor agonists. Neuropeptides. 2005;39(3):179–184. doi:10.1016/j.npep.2004.12.015
  15. Juréus A, Cunningham MJ, Li D, et al. Distribution and regulation of galanin-like peptide (GALP) in the hypothalamus of the mouse. Endocrinology. 2001;142(12):5140–5144. doi:10.1210/endo.142.12.8542
  16. Takatsu Y, Matsumoto H, Ohtaki T, et al. Distribution of galanin-like peptide in the rat brain. Endocrinology. 2001;142(4):1626–1634. doi:10.1210/endo.142.4.8089
  17. Cunningham MJ, Krasnow SM, Gevers EF, et al. Regulation of galanin-like peptide gene expression by pituitary hormones and their downstream targets. J Neuroendocrinol. 2004;16(1):10–18. doi:10.1111/j.1365-2826.2004.01118.x
  18. Lawrence C, Fraley GS. Galanin-like peptide (GALP) is a hypothalamic regulator of energy homeostasis and reproduction. Front Neuroendocrinol. 2011;32(1):1–9. doi:10.1016/j.yfrne.2010.06.001
  19. Kageyama H, Takenoya F, Kita T, Hori T, Guan JL, Shioda S. Galanin-like peptide in the brain: Effects on feeding, energy metabolism and reproduction. Regul Pept. 2005;126(1–2):21–26. doi:10.1016/j.regpep.2004.08.029
  20. Shiba K, Kageyama H, Takenoya F, Shioda S. Galanin-like peptide and the regulation of feeding behavior and energy metabolism. FEBS J. 2010;277(24):5006–5013. doi:10.1111/j.1742-4658.2010.07933.x
  21. Lang R, Gundlach AL, Kofler B. The galanin peptide family: Receptor pharmacology, pleiotropic biological actions, and implications in health and disease. Pharmacol Ther. 2007;115(2):177–207. doi:10.1016/j.pharmthera.2007.05.009
  22. Santic R, Fenninger K, Graf K, et al. Gangliocytes in neuroblastic tumors express alarin, a novel peptide derived by differential splicing of the galanin-like peptide gene. J Mol Neurosci. 2006;29(2):145–152. doi:10.1385/JMN:29:2:145
  23. Boughton CK, Patterson M, Bewick GA, et al. Alarin stimulates food intake and gonadotrophin release in male rats. Br J Pharmacol. 2010;161(3):601–613. doi:10.1111/j.1476-5381.2010.00893.x
  24. Van Der Kolk N, Madison FN, Mohr M, Eberhard N, Kofler B, Fraley GS. Alarin stimulates food intake in male rats and LH secretion in castrated male rats. Neuropeptides. 2010;44(4):333–340. doi:10.1016/j.npep.2010.04.001
  25. Mikó A, Füredi N, Tenk J, et al. Acute central effects of alarin on the regulation on energy homeostasis. Neuropeptides. 2017;64:117–122. doi:10.1016/j.npep.2016.09.001
  26. Jopek K, Tyczewska M, Ramanjaneya M, et al. Effect of ACTH and hCG on the expression of gonadotropin-inducible ovarian transcription factor 1 (Giot1) gene in the rat adrenal gland. Int J Mol Sci. 2018;19(8):2285. doi:10.3390/ijms19082285
  27. Ruciński M, Trejter M, Ziółkowska A, Tyczewska M, Malendowicz LK. Ghrelin and obestatin inhibit enucleation-induced adrenocortical proliferation in the rat. Int J Mol Med. 2010;25(5):793–800. doi:10.3892/ijmm_00000406
  28. Juréus A, Cunningham MJ, McClain ME, Clifton DK, Steiner RA. Galanin-like peptide (GALP) is a target for regulation by leptin in the hypothalamus of the rat. Endocrinology. 2000;141(7):2703–2706. doi:10.1210/endo.141.7.7669
  29. Kerr NC, Holmes FE, Wynick D. Galanin-like peptide (GALP) is expressed in rat hypothalamus and pituitary, but not in DRG. Neuroreport. 2000;11(17):3909–3913. doi:10.1097/00001756-200011270-00060
  30. Larm JA, Gundlach AL. Galanin-like peptide (GALP) mRNA expression is restricted to arcuate nucleus of hypothalamus in adult male rat brain. Neuroendocrinology. 2000;72(2):67–71. doi:10.1159/000054573
  31. Man PS, Lawrence CB. The effects of galanin-like peptide on energy balance, body temperature and brain activity in the mouse and rat are independent of the GALR2/3 receptor. J Neuroendocrinology. 2008;20(1):128–137. doi:10.1111/j.1365-2826.2007.01625.x
  32. Kauffman AS, Buenzle J, Fraley GS, Rissman EF. Effects of galanin-like peptide (GALP) on locomotion, reproduction and body weight in female and male mice. Horm Behav. 2005;48(2):141–151. doi:10.1016/j.yhbeh.2005.01.010
  33. Stoyanovitch AG, Johnson MA, Clifton DK, Steiner RA, Fraley GS. Galanin-like peptide rescues reproductive function in the diabetic rat. Diabetes. 2005;54(8):2471–2476. doi:10.2337/diabetes.54.8.2471
  34. Wang M, Chen Q, Li M, et al. Alarin-induced antidepressant-like effects and their relationship with hypothalamus–pituitary–adrenal axis activity and brain derived neurotrophic factor levels in mice. Peptides. 2014;56:163–172. doi:10.1016/j.peptides.2014.04.009
  35. Onaka T, Kuramochi M, Saito J, Ueta Y, Yada T. Galanin-like peptide stimulates vasopressin, oxytocin and adrenocorticotropic hormone release in rats. Neuroreport. 2005;16(3):243–247. doi:10.1097/00001756-200502280-00008
  36. Crown A, Clifton DK, Steiner RA. Neuropeptide signaling in the integration of metabolism and reproduction. Neuroendocrinology. 2007;86(3):175–182. doi:10.1159/000109095
  37. Gundlach AL. Galanin/GALP and galanin receptors: Role in central control of feeding, body weight/obesity and reproduction? Eur J Pharmacol. 2002;440(2–3):255–268. doi:10.1016/s0014-2999(02)01433-4
  38. Lawrence CB. Galanin-like peptide modulates energy balance by affecting inflammatory mediators? Physiol Behav. 2009;97(5):515–519. doi:10.1016/j.physbeh.2009.02.041
© Wroclaw Medical University